ID: 1165137638

View in Genome Browser
Species Human (GRCh38)
Location 19:33679940-33679962
Sequence CTGAGTAAGGGGGAGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165137631_1165137638 -10 Left 1165137631 19:33679927-33679949 CCACATCCAGCTACTGAGTAAGG No data
Right 1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 253
1165137630_1165137638 -9 Left 1165137630 19:33679926-33679948 CCCACATCCAGCTACTGAGTAAG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 253
1165137628_1165137638 6 Left 1165137628 19:33679911-33679933 CCCTTCTCTGGGCAACCCACATC 0: 1
1: 0
2: 2
3: 43
4: 228
Right 1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 253
1165137625_1165137638 23 Left 1165137625 19:33679894-33679916 CCTCATCTGAGATCACGCCCTTC 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 253
1165137629_1165137638 5 Left 1165137629 19:33679912-33679934 CCTTCTCTGGGCAACCCACATCC 0: 1
1: 0
2: 3
3: 67
4: 439
Right 1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165137638 Original CRISPR CTGAGTAAGGGGGAGGTGTA AGG Intronic
901631032 1:10648239-10648261 CTGAGTGATGGGGACGAGTAGGG - Intronic
903103126 1:21050943-21050965 CTGAATAAGGGGATGGGGTAGGG + Exonic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903853671 1:26322873-26322895 TTGAGTAAGGGGGAGGTAGCAGG - Intronic
903884486 1:26532864-26532886 CTGAGGAAGAGGGAGGAGTGTGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904470628 1:30733836-30733858 CTGAGTATGGGGGTGGTGCTGGG + Exonic
904581433 1:31546987-31547009 GTGAGTCAGAGGGAAGTGTAAGG + Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
905633008 1:39529418-39529440 CTGAGGAAGTGGCAGGTGTGCGG + Intergenic
906114548 1:43348041-43348063 ATGAGTAAGGGGAAGGGATAAGG - Intronic
906326281 1:44848111-44848133 CTGAGGAAGGGGGAGGCCCATGG - Intergenic
907810318 1:57863266-57863288 GTGTGTATGGGGGATGTGTAAGG + Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
911842150 1:102696658-102696680 CTGAGTGGGGCAGAGGTGTATGG - Intergenic
913187551 1:116382948-116382970 CTGCTTCAGGGGGAGGTGTCTGG + Intronic
913192755 1:116427108-116427130 CTGAGTAAGGGCCAGGTCAATGG - Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
915297553 1:154932036-154932058 CTGAGTGAGAGGGTGGTGTGAGG + Intronic
916215543 1:162390198-162390220 ATGATTAAGGGGGTGGGGTAGGG - Intergenic
916498757 1:165368680-165368702 CGGAGTAAGGGTCAGGAGTAGGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
918015820 1:180631942-180631964 CTGACGAAGGGGGTGCTGTAAGG - Intergenic
918475508 1:184919917-184919939 CTGGGGGAGGGGGAGGTGTTGGG + Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
921076219 1:211702197-211702219 GTGAGTGAGGAGGAGGTGTCTGG + Intergenic
923950273 1:238943827-238943849 CTGAGAAAGGGGGTAGTGTGTGG + Intergenic
1063732775 10:8718379-8718401 CTGAGTCAGGGGGAAGTAAAAGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067528561 10:47053548-47053570 CTGAGCCATGGGGAGGTGTTGGG + Intergenic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071667761 10:87577115-87577137 CTGAGTAGGGGGCAGGTTTGAGG + Intergenic
1071795627 10:89002085-89002107 CTGGGGAAAGGGGAGGTGTTTGG - Intronic
1072501669 10:96024003-96024025 CTGAGGAAGAGGCAGCTGTAGGG - Intronic
1072658246 10:97345732-97345754 CTGAGTGAGTGGGAGGGGTGTGG - Intergenic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1078480635 11:11672366-11672388 TTGAGCAAGGCGGAGGTGCATGG - Intergenic
1078737839 11:14036978-14037000 ATGAATAAGTGGGAGGTGAAGGG + Intronic
1079575940 11:22003159-22003181 CTGAGATAGGGAGAAGTGTAAGG + Intergenic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1081548365 11:44089106-44089128 CTGTGTAAGGGAGAAGTTTATGG - Intergenic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1086980536 11:93192372-93192394 ATGAGTGCGGGGGAGGAGTAGGG + Intronic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1088750835 11:112841108-112841130 ATGAGTAAGGGGTATGAGTAAGG + Intergenic
1090419187 11:126562308-126562330 CTGAGTAAGAGGGAGGGGTAGGG + Intronic
1090819306 11:130326669-130326691 CTGAGTAAGCGAGAGGAGAAGGG - Intergenic
1091543138 12:1480917-1480939 CAGAGTAAGGGGGACGTCTGGGG - Intronic
1091626367 12:2123935-2123957 CTTAGTAAGGGCGAAGTGTTGGG + Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091780829 12:3213644-3213666 CTGAGAAAGGGACAGGTGAAGGG - Intronic
1094167740 12:27459834-27459856 GTGAGTTAGGTGGAAGTGTATGG - Intergenic
1095182787 12:39165376-39165398 CTGAGTAAGTGGGAGAGGAAGGG + Intergenic
1095475496 12:42583295-42583317 CTGGGTAAGGTGGATGTGTCTGG + Intronic
1096503811 12:52080818-52080840 CTGGGGAATGGGGAGGTGTGTGG + Intergenic
1096572978 12:52534342-52534364 CTGAGAAAGGTCGAGGTGTTTGG - Intergenic
1098442059 12:70529313-70529335 ATGAGTTTGGGGCAGGTGTATGG + Intronic
1101086894 12:101245381-101245403 ATGAGGAAGAGGGAGGGGTAAGG - Intergenic
1101996401 12:109528302-109528324 CTGAGAAAGGGGGAGAGGAAGGG - Intronic
1102664013 12:114554537-114554559 CTGAGTGATGGGGGGGTGTTAGG - Intergenic
1104916690 12:132269184-132269206 CTGAGGCAGGGGGAGGCGTCGGG + Intronic
1105347423 13:19586948-19586970 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1107479829 13:40776849-40776871 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1107497849 13:40946388-40946410 GTGAGGAAGGGCGAGATGTAAGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108750150 13:53439919-53439941 CTGAGGTCGGGGGAGGTGTGGGG - Intergenic
1109673993 13:65648711-65648733 CTGAGGAAGGGAGGAGTGTACGG + Intergenic
1113009968 13:105752979-105753001 GTAAGTAAGGGGGAGGTGTAAGG - Intergenic
1113384502 13:109836151-109836173 CTCAGTAAGCGGCAGGTGAAGGG + Intergenic
1113931917 13:113973093-113973115 CTGAGCTAAGGGGAGGAGTAAGG + Intergenic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1114733344 14:25018037-25018059 CTGAGCAGGGGGGCAGTGTATGG - Intronic
1116265209 14:42679566-42679588 CTGTGGAAGGCTGAGGTGTAAGG - Intergenic
1116498445 14:45591089-45591111 ATGAGTAATTGGGAGGTGAAGGG + Intergenic
1121203931 14:92145340-92145362 GTGGGTTAGGGGGTGGTGTAGGG - Intronic
1121505249 14:94472246-94472268 CTGAGCAAGGGGTAGGTGAGTGG - Intronic
1123138444 14:106052076-106052098 CTGAGTAAAGGAGAGATGGACGG - Intergenic
1124346272 15:28923558-28923580 CTGAGTCTGGGGGAGGTGTGGGG + Intronic
1125258279 15:37792127-37792149 TTGAGAAAGGGGGAGATGAAGGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126280196 15:46938508-46938530 TTGAGTAGGGAGAAGGTGTAAGG - Intergenic
1128099723 15:64989168-64989190 CTGAGTGTGGGCCAGGTGTAAGG - Intronic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131340735 15:91598341-91598363 AAGAGGAAGAGGGAGGTGTAAGG + Intergenic
1131340744 15:91598394-91598416 AAGAGGAAGAGGGAGGTGTAAGG + Intergenic
1133110222 16:3543574-3543596 CTGAGTCAAGGGGTGGTGAAAGG - Intronic
1134242052 16:12513388-12513410 CTGAGTAGAGGGGAGGGGAAGGG - Intronic
1136316917 16:29459918-29459940 CTGAGTATGGGTGTGGTGTAGGG - Exonic
1136431492 16:30199260-30199282 CTGAGTATGGGTGTGGTGTAGGG - Intronic
1138008861 16:53359945-53359967 CTGAGGAGGGAGGAGGTGCAGGG + Intergenic
1138848198 16:60593207-60593229 GTGGGTAATAGGGAGGTGTAAGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1141556686 16:84841176-84841198 CTGACTGAGAGGGAGGAGTAAGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1146721949 17:35130027-35130049 CTGGGTATGGGGTAGGGGTATGG + Intronic
1147169092 17:38607652-38607674 CTGAGTTGGGGGCAGGTGAAGGG - Intergenic
1147219539 17:38920293-38920315 GTAAGTGAGGGGGAGGTCTAGGG - Exonic
1148289795 17:46434872-46434894 CAGAGTATGGGGGAGGGGCACGG - Intergenic
1148311963 17:46652444-46652466 CAGAGTATGGGGGAGGGGCACGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149836023 17:59913556-59913578 TTCAGTATGGGGGAGGGGTAAGG + Intronic
1150913608 17:69413809-69413831 CTCAGTAGGGGGTAGGTGTGGGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151294606 17:73175628-73175650 CTGCGTTGGGGGGAGGTGCAGGG + Intergenic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1151797060 17:76353515-76353537 CAGAGTAAGGGGGCGGTGGGAGG - Exonic
1151807767 17:76417185-76417207 CTGAGTCAGGGAGAGGTGCCAGG - Intronic
1152110823 17:78356918-78356940 CTGAGTAGGGGGGAGGAGAGAGG + Exonic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1153111689 18:1598137-1598159 CTGAGAAAGAGGGGGTTGTAGGG - Intergenic
1155895699 18:31323375-31323397 TGGAGTAAGGGTGAGGTGGATGG - Intronic
1158198792 18:54917118-54917140 CTGAGGAAAGGGGAAGTGAATGG + Intronic
1158552641 18:58449610-58449632 CTGTGTTAGGAGGAGCTGTAGGG + Intergenic
1158989686 18:62855863-62855885 GTGAGAAAGGAGGAGGTATAAGG + Intronic
1159904977 18:74081686-74081708 CTGAGTATGGTGGAGTTGGAGGG - Intronic
1164848031 19:31451053-31451075 CTGAGAAAGCAGGAGGTGTCAGG + Intergenic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1166528770 19:43529857-43529879 CTGAGACACAGGGAGGTGTAGGG + Intronic
1167263796 19:48473379-48473401 GTGAGTGAGGGGGAGGGGTTTGG + Intronic
1168169657 19:54576903-54576925 CTGAATAAGGGGGAGCTGCCTGG + Intronic
1168568290 19:57442579-57442601 TTGAGCAAGGGGGAGGTCTCTGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928800779 2:35088694-35088716 CTGAGTAATGGGGAAGAGAAGGG + Intergenic
931465245 2:62480578-62480600 TTGATTAAGGGTGAGATGTAGGG + Intergenic
931634865 2:64332071-64332093 CAGAGTAAAGGGCAGGTGTGTGG + Intergenic
932366072 2:71154364-71154386 CTGAGGAGGGAGGAGGTGCAGGG - Intergenic
933673900 2:85036003-85036025 CTTAGTAAGGGGCAGGGGTAGGG + Intronic
933942350 2:87254992-87255014 CTGAGTAGGGGGGAGGGGTATGG - Intergenic
936337876 2:111606577-111606599 CTGAGTAGGGGGGAGGGGTATGG + Intergenic
937019098 2:118633945-118633967 TGGAGTAGGGAGGAGGTGTAGGG - Intergenic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
941080463 2:161054913-161054935 CTGAGGAAAGGGGAGGTGATGGG + Intergenic
946348084 2:219127361-219127383 CAGAGAAAGAGGGAGGAGTAAGG - Intronic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
947109517 2:226703795-226703817 CTGCATAAGGGGGAGGGATAAGG + Intergenic
947880620 2:233507676-233507698 GTGACTGAGGGGGAGATGTAAGG + Intronic
948369644 2:237480531-237480553 ATGAGTGAGGGGGAGGCCTAGGG + Intergenic
948630768 2:239301159-239301181 CTGAGTAAGGGGGTGGTGCCCGG - Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
1170254989 20:14331776-14331798 CTCAGAAAGGGGAAGGTCTAAGG - Intronic
1171147736 20:22800507-22800529 CTTTGTAACGGGGAGGTGTCTGG + Intergenic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172911259 20:38410912-38410934 CTGAGAAAGGGATAGGTATAGGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1175442315 20:59000684-59000706 CTTTGTAGGGGAGAGGTGTAGGG - Intronic
1175603382 20:60293064-60293086 CAGAGTAGGGGGCAGCTGTAGGG + Intergenic
1176938557 21:14896296-14896318 CTGAGTACAGGGAAGGTGTGAGG - Intergenic
1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG + Intergenic
1181964073 22:26644341-26644363 CTGAGAAAGGGGGAGATTTATGG - Intergenic
1181979972 22:26759474-26759496 CTTTTCAAGGGGGAGGTGTATGG - Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951219568 3:20055029-20055051 GTGAGCCAGGGGGAGGTGAAAGG + Intronic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
951703681 3:25522720-25522742 CCGGGTAAGGGGGAGGTCTGCGG + Intronic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
953559234 3:43971858-43971880 GTAAGTGAGGGGGAGGTCTAGGG + Intergenic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955193391 3:56783058-56783080 TTGAATAAGGGAGAGGTATAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957788727 3:84913820-84913842 CTGAGAAAGGGGGTGGGGTGGGG - Intergenic
960181474 3:114585334-114585356 CTGAGTGAGGAGGAGGTTAAGGG + Intronic
960846004 3:122005221-122005243 GTGAGTGCGGGGGAGGTGTCAGG - Intronic
960885036 3:122384616-122384638 ATGGGTAAAGGGGAGGTCTAGGG - Intronic
961532384 3:127547515-127547537 CTGGGTCCGGGGGAGGGGTAGGG + Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
971109288 4:23565111-23565133 GGGAGTGAGGGGGAGGTGAAGGG - Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
971627320 4:28938637-28938659 ATGAGAAAGGGAGATGTGTAAGG - Intergenic
971979916 4:33738380-33738402 CTGAGTAGAGGGGAGGGGAAAGG + Intergenic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
976761775 4:88557022-88557044 TGGAGGAAGGGGGAGATGTATGG - Intronic
984694444 4:182765611-182765633 GTGAGTAAGGAGGAAGGGTAAGG - Intronic
988331123 5:29841326-29841348 CTGAGCAAGAGGGAATTGTATGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989794326 5:45447792-45447814 CTCAAAAAGGGGGAGGTGTTTGG + Intronic
990744924 5:58950077-58950099 CTGCGTTAGGGGGAGGTCAATGG - Intergenic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
991605444 5:68396148-68396170 ATGAGGAAGGGGGAGGGGAAAGG + Intergenic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999908491 5:156169835-156169857 ATGAGTAAGGGGGAGTTGGTGGG + Intronic
1000166411 5:158653436-158653458 TTGAGTAAGAGGGGTGTGTAAGG - Intergenic
1000378124 5:160603066-160603088 CTGACTCAGGGGGTGGTGAAAGG - Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001848429 5:174941761-174941783 CTCAGTAAAGGGGAGGTGATGGG + Intergenic
1002634748 5:180601747-180601769 CAGAGGAAGGGGGAGGTCCACGG + Exonic
1003020403 6:2504728-2504750 CTGAGAAGTGGGGAGGGGTAAGG - Intergenic
1003164298 6:3662916-3662938 CTGAATGAGGGGGAAGTGTGTGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005835753 6:29708078-29708100 TTGAATAAGGGCAAGGTGTATGG - Intergenic
1006307826 6:33235261-33235283 CTGAGTGAGGTGGAGGGGTCTGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1009878457 6:69535581-69535603 TTGAGTGAGGGCGAGGGGTAGGG - Intergenic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014173309 6:118303535-118303557 CTAAGGAAGGTGGAGGTGTGAGG - Intronic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019566846 7:1687116-1687138 CTGAGTTGGGGGGAGGTGCGGGG + Intergenic
1022163498 7:27735060-27735082 CTGAGAAGGTGGGAGGTGTTGGG + Intergenic
1023770480 7:43552322-43552344 CTGAGTACCGGGGAGGTGAGTGG + Exonic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027195052 7:76024242-76024264 CTCAAAAAGGGGGAGGTGTTGGG + Intronic
1028985092 7:97003249-97003271 CTAAGTAAGGGGGAGATGTGGGG - Intergenic
1030185643 7:106759078-106759100 GTGACAAAGGGGGTGGTGTAAGG - Intergenic
1031227073 7:119052940-119052962 CTGAGTAGGGTGGAGGTGCTGGG + Intergenic
1031370745 7:120962549-120962571 GTGAGTTAGGGCAAGGTGTATGG + Intronic
1031583567 7:123506280-123506302 CTGGGTAATGGGCAGGTGTTTGG - Intronic
1034324010 7:150213083-150213105 CTCAGGAACAGGGAGGTGTAGGG + Intergenic
1034483641 7:151342068-151342090 CTGAGTTAGGCAGAGGTGTGGGG + Intronic
1034769187 7:153756154-153756176 CTCAGGAACAGGGAGGTGTAGGG - Intergenic
1037614069 8:20501624-20501646 CTGATTAGTGGGGAGGTGAATGG - Intergenic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1037952431 8:23027911-23027933 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1037963654 8:23117476-23117498 CTGAGGAAGGGGGATGAGAAGGG - Intergenic
1037967399 8:23145246-23145268 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1038311715 8:26450059-26450081 CTGAGAGAGGGGCAGCTGTAGGG + Intronic
1042186847 8:66144679-66144701 CAGAGAAGAGGGGAGGTGTATGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044712848 8:95073564-95073586 CTGCGGAAGGGGGACGTTTAAGG - Intronic
1045663722 8:104465139-104465161 CTTGGAGAGGGGGAGGTGTAAGG + Intronic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1047966784 8:130050852-130050874 CGGAGTCAGGGGGTGGTGAAGGG + Intergenic
1047975086 8:130121949-130121971 CTGAGCAAGAGGGAGATGCAGGG - Intronic
1049413856 8:142486201-142486223 CTGAGTGAGGGAGGGATGTAGGG - Intronic
1049541194 8:143209971-143209993 CTGACTGAGGGGCAAGTGTAGGG - Intergenic
1053571501 9:39313583-39313605 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054093060 9:60872285-60872307 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054114537 9:61148197-61148219 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054125644 9:61305429-61305451 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1054593217 9:67034330-67034352 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1056780002 9:89542112-89542134 CTGAGCCAGGGAGAGGTGAATGG - Intergenic
1057472329 9:95368840-95368862 CAGAGTTAGGAGGAGGTGTGAGG + Intergenic
1057810697 9:98254936-98254958 CTGAGTCAGAGGGAGATGAAAGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1060143944 9:121234937-121234959 CTGAGAAACAGGGAGGTGTGGGG + Intronic
1060176071 9:121498621-121498643 CTGAGGAAGCAGGAGATGTAGGG - Intergenic
1061425480 9:130495702-130495724 TTGAGTAGGTGGGAGGTGGAAGG + Intronic
1061732287 9:132625040-132625062 CTGAGTAAGGGGGTGGGGTGGGG + Intronic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1185545746 X:942586-942608 GAGAGGAAAGGGGAGGTGTATGG + Intergenic
1187830869 X:23379990-23380012 CTCAGTGAGGAGGACGTGTAAGG - Exonic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1193947033 X:87750989-87751011 CAAAGAAAAGGGGAGGTGTAGGG + Intergenic
1194296047 X:92127819-92127841 CTTAGAAAGGGGGAAGGGTAAGG - Intronic
1196940341 X:120769584-120769606 CAGAATTAGGGGGAGGGGTAAGG + Intergenic
1197224326 X:123941423-123941445 TGGAGTAAGGGGGAAGGGTATGG - Intergenic
1200613550 Y:5352420-5352442 CTTAGAAAGGGGGAAGGGTAAGG - Intronic
1201310648 Y:12595794-12595816 CTGACTAGGGGAGAGGTTTAGGG + Intergenic