ID: 1165138608

View in Genome Browser
Species Human (GRCh38)
Location 19:33686131-33686153
Sequence CTCTCTATACCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165138608_1165138613 -2 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138613 19:33686152-33686174 AGAGGGTGTTCGTGTTCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 154
1165138608_1165138617 11 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138617 19:33686165-33686187 GTTCTCTCGGGGGCCAGCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1165138608_1165138623 29 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138623 19:33686183-33686205 AAAGGCAGGGTCTTTGAAAGGGG 0: 1
1: 0
2: 1
3: 41
4: 292
1165138608_1165138615 0 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138615 19:33686154-33686176 AGGGTGTTCGTGTTCTCTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 48
1165138608_1165138616 1 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138616 19:33686155-33686177 GGGTGTTCGTGTTCTCTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1165138608_1165138614 -1 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138614 19:33686153-33686175 GAGGGTGTTCGTGTTCTCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 130
1165138608_1165138621 27 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138621 19:33686181-33686203 GCAAAGGCAGGGTCTTTGAAAGG 0: 1
1: 0
2: 2
3: 16
4: 241
1165138608_1165138622 28 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138622 19:33686182-33686204 CAAAGGCAGGGTCTTTGAAAGGG 0: 1
1: 0
2: 3
3: 39
4: 335
1165138608_1165138619 16 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138619 19:33686170-33686192 CTCGGGGGCCAGCAAAGGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 177
1165138608_1165138618 15 Left 1165138608 19:33686131-33686153 CCAGCTTCCCTGGGTATAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1165138618 19:33686169-33686191 TCTCGGGGGCCAGCAAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165138608 Original CRISPR CTCTCTATACCCAGGGAAGC TGG (reversed) Intronic
900986548 1:6076544-6076566 CTCTATCAACCCAGGGAGGCAGG + Intronic
909770454 1:79415009-79415031 CTCGTGATACCCAGGAAAGCAGG + Intergenic
910044662 1:82897799-82897821 CCTTCTATACCAAGGGAAACAGG - Intergenic
911171591 1:94776138-94776160 CTCTCTTACCTCAGGGAAGCGGG - Intergenic
911778009 1:101839721-101839743 CTCTCTGGAACCAGGGAAGTGGG + Intronic
912452043 1:109773265-109773287 CTCTCCAGCCCCAGGGCAGCTGG + Intronic
912650288 1:111432665-111432687 CAGTCTATACCCAAGGATGCAGG - Intergenic
915148823 1:153812489-153812511 CTCTCTTTCTCCAGGAAAGCTGG + Intronic
918041419 1:180916304-180916326 CTCCCCATACCCTGGGAGGCTGG - Exonic
920672336 1:208014116-208014138 ATCTCTCTACCCAGGGTAGTGGG + Intergenic
920866253 1:209756389-209756411 CACTCTCCACCCAGGGGAGCTGG - Intronic
923939358 1:238802989-238803011 ATCTATATAACCAGGAAAGCTGG - Intergenic
1064185645 10:13159673-13159695 CTCTGTATGCCCAGGGAAAGCGG - Intergenic
1064903131 10:20315814-20315836 CTCACTGGACCCAGGCAAGCTGG - Intergenic
1068897763 10:62226453-62226475 CTCTCTATACCCAGTGTTTCTGG + Intronic
1069530943 10:69218988-69219010 ATCTCAATCCCCAGGGTAGCTGG - Intergenic
1070439689 10:76431387-76431409 CTGTCGTCACCCAGGGAAGCAGG - Intronic
1074210973 10:111334831-111334853 ATCTCCATACCAAGGGAAGAAGG - Intergenic
1074545128 10:114396231-114396253 GGCTCTGTACCCTGGGAAGCTGG - Intronic
1074654637 10:115571016-115571038 TTCTCCATCCCCAGTGAAGCTGG - Intronic
1075428076 10:122357607-122357629 CTCTCTATAGCCAGAGGACCAGG + Intergenic
1075805811 10:125188027-125188049 CTATCTCTATCCAAGGAAGCAGG - Intergenic
1076184632 10:128436697-128436719 CTCTATTTATCCTGGGAAGCTGG - Intergenic
1076491845 10:130867084-130867106 CTCTCTACCCCCACAGAAGCGGG - Intergenic
1076494836 10:130890155-130890177 CCCTCTCTGCCTAGGGAAGCCGG + Intergenic
1076571698 10:131437437-131437459 CTCTCTCCACCCACGGAAGGTGG + Intergenic
1077383231 11:2257218-2257240 CTCCCTAGCCCCAGGGCAGCCGG - Intergenic
1077438006 11:2553443-2553465 CTCTCTATTCCCAGCAAACCAGG - Intronic
1077497529 11:2893434-2893456 CACTCTATACCCAGAGATGTGGG + Intronic
1078878646 11:15425196-15425218 CTCTCAATACTGAGGGAAGCAGG - Intergenic
1080004572 11:27393199-27393221 TTCTCTATGCCCAGGGAAATAGG - Intronic
1083161287 11:60855807-60855829 CTCTCTAGACCCACAGAAGAAGG - Intronic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1087055964 11:93936603-93936625 TGCTCTATCCCCAGGGAAGGTGG - Intergenic
1087249463 11:95880665-95880687 CTCACTATAATCAGGGAATCAGG - Intronic
1087709215 11:101530285-101530307 CTGTATGTACCCTGGGAAGCAGG + Intronic
1087895534 11:103581797-103581819 CTCTCTATAATCATGGAAACTGG - Intergenic
1089844397 11:121447081-121447103 CTCTATATTCCCAGGGAAAGAGG + Intergenic
1090657890 11:128859785-128859807 TTCTCAAGACCCAGGGAAGTGGG + Intronic
1090669841 11:128938496-128938518 GTCCCTCAACCCAGGGAAGCTGG + Intronic
1090737621 11:129624101-129624123 CTCTGTGCATCCAGGGAAGCTGG + Intergenic
1091068957 11:132544871-132544893 CTCGCTGTACTCAGGGAAGCTGG + Intronic
1091994269 12:4980899-4980921 CTCGCTCAACCCAGGGAAGTTGG - Intergenic
1096526173 12:52211680-52211702 CTTTCTGTTCCAAGGGAAGCTGG + Intergenic
1096869722 12:54585716-54585738 CTCTCTATGCCCAGAAAAGTGGG + Intronic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1096953289 12:55498840-55498862 CTCTCTACTCCAAGGGATGCTGG - Intergenic
1097225132 12:57472558-57472580 TGCTCTCTACCCAGGGCAGCTGG - Exonic
1100006514 12:89901469-89901491 CTCTCCCTTCCCAGGGAGGCAGG + Intergenic
1102905726 12:116673884-116673906 CTCCCTAGAACCAGTGAAGCAGG - Intergenic
1104536826 12:129625443-129625465 ATTTCCATACCCAGGGGAGCTGG + Intronic
1106391066 13:29336443-29336465 CTCGTGATACCCAGGCAAGCAGG - Intronic
1107414288 13:40187054-40187076 CTCTCTGTCCCCAGGTAAGGTGG + Intergenic
1108832723 13:54499619-54499641 CTTTCTCTAACTAGGGAAGCTGG + Intergenic
1109202692 13:59448570-59448592 TTCTCTATTCCCAGGGTAGAAGG - Intergenic
1110930568 13:81211147-81211169 CTATCAATACCCATGGCAGCTGG + Intergenic
1116013784 14:39382115-39382137 CTCTCCATCGTCAGGGAAGCAGG + Intronic
1116636569 14:47403852-47403874 CACTCTATACCCAGAGAAAAGGG + Intronic
1116820019 14:49618988-49619010 CTTTGTATGCCCAGGGAAGGAGG - Exonic
1117786608 14:59292245-59292267 CACTCTCGACCCAGGGAAACAGG + Intronic
1118895684 14:69943495-69943517 CTCTCCATTCCCAAGGATGCAGG + Intronic
1119083085 14:71715153-71715175 CTCTCTACCCCCAGGCAAGTTGG + Intronic
1119202475 14:72766860-72766882 CTCTCTCTAGCCAGAGAACCAGG + Intronic
1122616058 14:103018831-103018853 CTCCCCATCCCCATGGAAGCTGG - Intronic
1124214442 15:27794992-27795014 CTCACTATAGCATGGGAAGCAGG + Intronic
1125016570 15:34943174-34943196 CTCTGTATGCCCAGGGAAAGCGG + Intronic
1126740215 15:51769646-51769668 CTGTCTATAGCTGGGGAAGCTGG - Intronic
1129118864 15:73382782-73382804 CTCTGTATACCCAGGGCTGATGG + Intergenic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1129715979 15:77851209-77851231 CTGTCAACACCCAGGGAAGTGGG + Intergenic
1133120972 16:3607482-3607504 CTCAGTATACCAAGGGCAGCAGG + Intronic
1133908032 16:10039367-10039389 CTCTCTATCCCCAGGGTCTCAGG + Intronic
1134014262 16:10877760-10877782 CACTCCATACCCAGAGAAGCAGG + Intronic
1137471145 16:48759552-48759574 CTGTTGATACCCAGGGAAACAGG + Intergenic
1138191317 16:55016399-55016421 CTCTCCATCCCCAGGAAAGGGGG + Intergenic
1139612682 16:68070119-68070141 CTTTCTATCTCCAAGGAAGCGGG + Exonic
1142275639 16:89117511-89117533 CTGTCTACACCCAGGGAGTCAGG + Intronic
1143008539 17:3852859-3852881 CTCACTAGACCAAGGGAAGGAGG - Intergenic
1144022830 17:11252150-11252172 CTCTCCAGACCCACGGACGCAGG + Intronic
1146611224 17:34306637-34306659 CTCTGTATCCCCAGGAAAACTGG - Intergenic
1146929334 17:36766695-36766717 TTCTCTATGCAAAGGGAAGCTGG + Intergenic
1147306522 17:39568121-39568143 CTCCCTAGACCCTGGGAAGCAGG + Intergenic
1148247052 17:46039308-46039330 CGCCGTATACCCAGGGCAGCAGG + Intronic
1149432694 17:56607036-56607058 CTATTTGTACCCAGAGAAGCTGG + Intergenic
1150655548 17:67036917-67036939 CTCTCTATTACCATGGAAGAGGG - Intergenic
1151441959 17:74135434-74135456 TGCTCTAGACCCAGAGAAGCAGG - Intergenic
1151634802 17:75338921-75338943 CTCTGTATGCCCAGGGAAAGCGG + Intronic
1152206969 17:78979437-78979459 CTCTCTCTACACAGGCAAGTGGG - Intronic
1154150502 18:11902848-11902870 CTCTCTTCATCCAGGGAAGCTGG - Intronic
1154388915 18:13919807-13919829 CTCTGTATGCCCAGGGAAAGTGG - Intergenic
1157560814 18:48644678-48644700 GTCTCTGCACTCAGGGAAGCTGG + Intronic
1158167287 18:54554803-54554825 CTCTCTATTGCCATGGAAGCAGG + Intergenic
1158836241 18:61334059-61334081 CTCTCTGGAAGCAGGGAAGCTGG + Intronic
1160157439 18:76444315-76444337 CTCTCTGGACCCTTGGAAGCAGG - Intronic
1160529404 18:79554837-79554859 CTCTCCTCGCCCAGGGAAGCTGG - Intergenic
1161024699 19:2030937-2030959 CTCTCTGAACCCAGGGAAAGTGG - Intronic
1161283291 19:3456930-3456952 CCATCTATACCATGGGAAGCAGG - Intronic
1161335317 19:3709757-3709779 CTCTCAAAACCCAGGCAAGGTGG - Intronic
1162332997 19:10041859-10041881 CTCACTACACCCAGGGACTCAGG + Intergenic
1164333569 19:24285046-24285068 CTCTTGATACCCAGGCAAACAGG - Intergenic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
1168267722 19:55231551-55231573 CTCTCTCTGCCCAGGGCCGCGGG + Intronic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
927588750 2:24334606-24334628 CTCTGTATGCCCAGGGAAAGTGG + Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
928451180 2:31379924-31379946 CTTTCTGTAGCCAGGGAAGAAGG + Exonic
928807455 2:35176904-35176926 CTCTCTCTAGCTAGGAAAGCCGG - Intergenic
931746867 2:65298546-65298568 CTCTCTAGGCCCAGGGGAGTGGG + Intergenic
932175244 2:69594945-69594967 CTCTGTATGCCCAGGGAAAGTGG - Intronic
933339014 2:80998106-80998128 CACTCTATCCCCTGGGAAGAGGG - Intergenic
934853978 2:97717829-97717851 CTGCCTTTACCCAGGGAGGCTGG + Intronic
937625457 2:124038392-124038414 CTCTCTAAACCCAAGCAAGCAGG - Intronic
937908051 2:127061956-127061978 CTCTCTGTGCTCAGGGAGGCAGG - Intronic
938389404 2:130893229-130893251 CTCTCTAGAGACAGGGAGGCGGG - Intronic
940865789 2:158816747-158816769 TTCTCTTTACCCAGGGAAAGGGG + Intronic
943785832 2:191877713-191877735 CTCCTTATACCCTGGGAACCAGG + Intergenic
947191225 2:227507221-227507243 CTCTGTATACCCATGAAAACAGG - Intronic
947484601 2:230536634-230536656 GTATCTATATTCAGGGAAGCAGG - Intronic
947714871 2:232334357-232334379 CTCCCTATAGCCTGGGAAGAGGG - Exonic
947733945 2:232445308-232445330 CTCCCTATAGCCTGGGAAGAGGG - Intergenic
1170552571 20:17490190-17490212 CCCTCTCTACCCAGTGATGCTGG - Intergenic
1170701457 20:18707497-18707519 CACTCTATGGCCAGAGAAGCTGG - Intronic
1171300388 20:24054913-24054935 CTCTATATACCCAGAACAGCTGG - Intergenic
1171375560 20:24691966-24691988 CTCTCTACACCCAGGAGACCTGG - Intergenic
1172154018 20:32811006-32811028 GTCTCAATACCCGGGGAGGCAGG - Intergenic
1172154533 20:32814576-32814598 CTATCTATACATAGGGAAGGAGG - Intergenic
1174426687 20:50436615-50436637 CTCCCTTTGCCCAGGCAAGCAGG + Intergenic
1178405125 21:32317300-32317322 CTCTTTAAACACAGGGAATCAGG + Intronic
1183241831 22:36663368-36663390 CCCTCTATACTCAGGGAAATTGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
951532564 3:23711516-23711538 CTCTTTATCCACAGAGAAGCTGG + Intergenic
952808724 3:37382080-37382102 CTCTCTCTAGCCAAGGAACCAGG - Intergenic
953702522 3:45207829-45207851 CAGGCTATACCCAGGGAAGTGGG - Intergenic
954785526 3:53089707-53089729 CTCCCTAGATACAGGGAAGCAGG + Exonic
956020319 3:64926835-64926857 CTAACTATAGCCAGGGTAGCAGG + Intergenic
961332321 3:126149836-126149858 TTCTCTCCACCCAGGGAAGAAGG + Intronic
963281219 3:143386268-143386290 CTGTTTATACCCAGGCATGCAGG + Intronic
968808329 4:2788859-2788881 CCTCCTATCCCCAGGGAAGCAGG + Intergenic
969474683 4:7414982-7415004 CTCTCTCTAGCTAGGAAAGCCGG - Intronic
969962616 4:10960821-10960843 CTCTCTAGGACCAGGGCAGCAGG - Intergenic
975483592 4:74909555-74909577 GTCTCTATACCCACTGAAGAGGG - Intergenic
976211476 4:82675994-82676016 ATATCTGTACCCAGGGAAACAGG - Intronic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977055066 4:92181969-92181991 CTCTTTACTACCAGGGAAGCGGG + Intergenic
978744012 4:112171310-112171332 CTCTGTATGCCCAGGGAAAGCGG + Intronic
984449783 4:179884918-179884940 CTTTCTTTACACATGGAAGCAGG + Intergenic
987026392 5:13930842-13930864 CTCTCTACATCCAGTGAAGCTGG - Intronic
991228321 5:64299141-64299163 CTGTCTATAACCAAGGAATCAGG + Intronic
991455766 5:66802266-66802288 CTCTCTGTATTCATGGAAGCTGG + Intronic
992011468 5:72531914-72531936 CTCTCTATGCCTAGAGAGGCAGG + Intergenic
992583056 5:78201885-78201907 CTCTCTCTACACAGGGGAGGAGG + Intronic
994416437 5:99477615-99477637 CTCCCTAGACACTGGGAAGCTGG + Intergenic
994463530 5:100097558-100097580 CTCCCTAGACACTGGGAAGCTGG - Intergenic
994540439 5:101089304-101089326 CTCTACATACACAGGGAAGTAGG + Intergenic
997990999 5:138544109-138544131 CTCTGTATCCCCAGGAAAACAGG - Intergenic
998401508 5:141851154-141851176 ATCTCTCTTCCCAGGGAAGGGGG - Intergenic
1004334954 6:14756216-14756238 TTCTCTACACCAAGGGAAGATGG + Intergenic
1005147441 6:22707575-22707597 CTCTCTTGCCCCAGGGAAGAGGG + Intergenic
1007753540 6:44084215-44084237 ATCTCTATTCCCAGGGAATGTGG - Intergenic
1007835164 6:44668363-44668385 GTCTCTTTCCCCAGGGACGCTGG - Intergenic
1015062956 6:128989863-128989885 CTGTCTATAAACAGGAAAGCAGG - Intronic
1015603534 6:134933488-134933510 CTATCTTGGCCCAGGGAAGCAGG + Intronic
1018427296 6:163694903-163694925 CACTCAACACCCAGGAAAGCAGG + Intergenic
1018462348 6:164010455-164010477 CTTTCTATCCCCAGTGAAGATGG + Intergenic
1019088698 6:169505466-169505488 TTCTCTATACTTAGGGAAACAGG + Intronic
1020007056 7:4788685-4788707 CTCCCCAAACCCAGGGGAGCAGG + Intronic
1021282781 7:18740562-18740584 CTCTCTATTCCCAGAGACACTGG + Intronic
1023216262 7:37866397-37866419 CTTTCTACACACATGGAAGCCGG - Intronic
1024346900 7:48322562-48322584 CTCTCAATGCCCAGGGCAGCCGG + Intronic
1032130357 7:129222940-129222962 CTCTCTATGCTCAGAGAAACAGG - Intergenic
1032197232 7:129796443-129796465 TTCCCCATATCCAGGGAAGCAGG - Intergenic
1032786320 7:135203263-135203285 CTCGCTGTACCCAGGGAGGTAGG - Intronic
1040681648 8:49818126-49818148 CTTGCTATAGCCAGGGAGGCAGG + Intergenic
1041696919 8:60745364-60745386 CTCTTAAAACCCAGGAAAGCTGG - Intronic
1041771251 8:61474767-61474789 CTCTATTTTCCCAGTGAAGCAGG + Intronic
1042860289 8:73306234-73306256 CTGTATAAACCCAGGGATGCAGG - Intronic
1046355617 8:113081520-113081542 CTCCCTATACTCAGGGTATCGGG - Intronic
1047108135 8:121757943-121757965 TTCTCTATCCCGAAGGAAGCTGG + Intergenic
1053619394 9:39800208-39800230 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053877554 9:42559547-42559569 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053895100 9:42734830-42734852 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054234140 9:62542147-62542169 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054264762 9:62907235-62907257 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1055271717 9:74567352-74567374 CTCTCTAGTCCCAGGAAAGCTGG + Intronic
1056417496 9:86390796-86390818 CTGGCTATACCCAGGCAAACAGG + Intergenic
1059430819 9:114249360-114249382 TTCTCTGAACCCAGGGAACCAGG + Intronic
1059749647 9:117236035-117236057 CTCTCTCAACCCTGGGAATCTGG + Intronic
1060805737 9:126575006-126575028 CTCCCTACCCCCAGTGAAGCTGG - Intergenic
1060940592 9:127540979-127541001 CTCCCTATGCCCTGGGAACCAGG - Intronic
1061593397 9:131613376-131613398 CTCTGAAGAGCCAGGGAAGCTGG + Intronic
1062253832 9:135611622-135611644 CTCTCTCTACCCAGGTGTGCAGG + Intergenic
1185669490 X:1794845-1794867 CCCTCTCCACCCAGGGACGCTGG - Intergenic
1186164783 X:6814991-6815013 GTGTCTATATCCAGGGAACCTGG - Intergenic
1186664539 X:11704200-11704222 CTCTCTGTACCTGGGGGAGCTGG - Intergenic
1187009358 X:15264531-15264553 CTCCCTACCCCCAGGGAAGTGGG + Intronic
1187933289 X:24313057-24313079 CAATCTATACCCAGGCAATCAGG - Intergenic
1187938938 X:24362997-24363019 CAATCTATACCCAGGCAATCAGG + Intergenic
1189575539 X:42349095-42349117 CTCTCTCTAGCCAGAGAAGCAGG - Intergenic
1189863765 X:45301357-45301379 CTCTCAATCGTCAGGGAAGCAGG - Intergenic
1192230598 X:69262247-69262269 CTCCCTATACCTAGGGTTGCTGG + Intergenic
1194700632 X:97109537-97109559 TTCTCTAAACCCAGGAAAGAGGG - Intronic
1195542264 X:106076210-106076232 CTCTCTATCCACAGTGAGGCTGG - Intergenic
1197838584 X:130721152-130721174 AGCACTGTACCCAGGGAAGCAGG - Intronic
1199548581 X:149033684-149033706 CTCCAGATACCCATGGAAGCAGG - Intergenic
1199845069 X:151686868-151686890 CTCACTAGAACCAGGGAAGTGGG + Intergenic
1201409656 Y:13686654-13686676 CTCTCTATAGTCATGGAAGCAGG + Intergenic