ID: 1165139798

View in Genome Browser
Species Human (GRCh38)
Location 19:33691880-33691902
Sequence CCATGGCATGAACTGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165139798 Original CRISPR CCATGGCATGAACTGTCCTG GGG Intronic
900312660 1:2041688-2041710 CCAGGGCGTGGACTGGCCTGGGG - Intergenic
901665563 1:10824310-10824332 CCATGGACTGAACTCTCCTGCGG + Intergenic
904386990 1:30149410-30149432 CCAGGGCATCAACTTTCATGGGG + Intergenic
908915609 1:69122340-69122362 CCATGGTATGAACTGTCTGGTGG + Intergenic
909212184 1:72838002-72838024 CCAGGGCATGATGTGTCATGAGG + Intergenic
914489097 1:148138801-148138823 CCATGGCCTGACCTGAACTGTGG - Intronic
916638745 1:166703141-166703163 AAATGGCATGAACTTCCCTGAGG - Intergenic
918166028 1:181948664-181948686 CAATGGCATGAACTGTACATTGG - Intergenic
923348368 1:233079777-233079799 ACAAAGCAAGAACTGTCCTGAGG - Intronic
1067385826 10:45817246-45817268 CCATGGCATGAACTGAACAGAGG + Exonic
1067449225 10:46371128-46371150 CCACGGCATGAACTGAACAGAGG - Exonic
1067588145 10:47489637-47489659 CCACGGCATGAACTGAACAGAGG + Exonic
1067635270 10:47997728-47997750 CCACGGCATGAACTGAACAGAGG + Intergenic
1068907889 10:62347022-62347044 CCAGGGCATGAAATGTCCACAGG + Intergenic
1069650357 10:70042761-70042783 CCAGGGCATACACTGCCCTGGGG - Intergenic
1069764868 10:70847968-70847990 CAGCGGCATGAACTGTGCTGGGG + Intronic
1070247935 10:74749359-74749381 TCATCGGAGGAACTGTCCTGAGG - Intergenic
1070396508 10:76015467-76015489 CCAAGTCATGAGCTGTCCTATGG - Intronic
1071609846 10:87022303-87022325 CCACGGCATGAACTGAACAGAGG - Exonic
1072067408 10:91884400-91884422 CCTTGGCATGAAATGGCCTCTGG - Intergenic
1072486076 10:95857160-95857182 CGATGGCATGTAGTGTCTTGGGG + Intronic
1074025253 10:109627312-109627334 CCATGGCCTGAACTGAACTTTGG + Intergenic
1074939129 10:118217573-118217595 CCATGGCAAGAACTGACTTGTGG + Intergenic
1078416159 11:11167886-11167908 CCATGTCATGATCTGCACTGTGG - Intergenic
1080901340 11:36495023-36495045 CCATGACCAGAACTGTCCTTTGG - Exonic
1082779764 11:57278011-57278033 GCATGGCATGAAATGGCCTCTGG - Intergenic
1083187649 11:61026901-61026923 CCATGACACGTTCTGTCCTGGGG + Intergenic
1084118926 11:67057598-67057620 CCATGGCATGTGCTTTCCAGCGG - Intronic
1085834227 11:79935224-79935246 CCTTGGCATGAACAGTCTTTAGG - Intergenic
1087301361 11:96439904-96439926 CCATGGCTTGAGCTGTACTTGGG + Intronic
1087709415 11:101531979-101532001 GCATGGCAAGAAGTGTCCTGAGG + Intronic
1088048365 11:105480493-105480515 CCATGGCCTGAACTGTACCTTGG - Intergenic
1090490430 11:127155732-127155754 CCACAGCAGGAACTGGCCTGGGG + Intergenic
1092860546 12:12716488-12716510 CCATGGCCTTAACTGTGCTTGGG + Intronic
1094675228 12:32613204-32613226 CCATAGCATGAGTTGTCATGGGG + Intronic
1095923773 12:47558021-47558043 TGAGGGCAGGAACTGTCCTGGGG - Intergenic
1096495255 12:52036269-52036291 CCATGGTAAGAATTTTCCTGGGG - Intronic
1098098135 12:66982540-66982562 CCATGTTATGATCTGCCCTGTGG + Intergenic
1098686950 12:73434124-73434146 CCATGGCCTGAACTGTGCCTTGG - Intergenic
1099948973 12:89278788-89278810 CAACGGCATTCACTGTCCTGCGG + Intergenic
1100584105 12:95963415-95963437 CCAAGACATGAATTGTACTGAGG + Intronic
1100674897 12:96856085-96856107 CCATGGCCTGAGCTGTACCGTGG + Intronic
1100982254 12:100171052-100171074 CCATGGGTGGAACTGTCCTGGGG - Intergenic
1105857507 13:24386103-24386125 CCATGGCAGGATCTCACCTGGGG - Intergenic
1108167416 13:47708107-47708129 TCATGACATGAACTGGCCTGGGG - Intergenic
1109636481 13:65124540-65124562 GCAGGGCATCAACTGTCTTGAGG + Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114443098 14:22766820-22766842 CCCTAGCACGAGCTGTCCTGGGG - Intronic
1117873630 14:60226515-60226537 GCATGGTGTGAACTGTCCTATGG - Intergenic
1121485972 14:94314579-94314601 CCATGGCCTGGACGGTCCAGAGG + Exonic
1122345408 14:101055561-101055583 CCATGGCAAGCATTTTCCTGAGG + Intergenic
1126942460 15:53781316-53781338 CCATGGCCTGAGCTGTACTTTGG + Intergenic
1132303817 15:100794056-100794078 CAATGGCCTGACCTGTACTGTGG + Intergenic
1132808599 16:1787189-1787211 CCATGGCATGCAGGGACCTGAGG + Intronic
1133398511 16:5467376-5467398 CTAAGGGATGAACTGTGCTGTGG - Intergenic
1133592507 16:7259430-7259452 CAATGGCATGAACTCTACAGGGG - Intronic
1134018668 16:10906851-10906873 CCATTGCTTGAACCGTCCGGGGG + Exonic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1146475688 17:33160820-33160842 CCAGGGCATGAATTGTCCCAGGG - Intronic
1151434879 17:74089077-74089099 CCACTGCAGGAGCTGTCCTGTGG + Intergenic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1153536371 18:6106514-6106536 GCATGGGATGAACTGTAATGTGG + Intronic
1156208027 18:34907050-34907072 CCATGGCTGGAAGTTTCCTGAGG - Intergenic
1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG + Intergenic
1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG + Exonic
1159764135 18:72465954-72465976 CTAGGTCATGAACTGACCTGTGG - Intergenic
1160779653 19:872167-872189 CGATGGGATGAAGTGTCTTGGGG + Intronic
1161512335 19:4678750-4678772 CCTCGGCATGCTCTGTCCTGTGG - Intronic
1165004641 19:32794926-32794948 CCAGGCCAGAAACTGTCCTGTGG + Intronic
1165139798 19:33691880-33691902 CCATGGCATGAACTGTCCTGGGG + Intronic
1165145818 19:33729350-33729372 CTATGCCATGAACTGTGCTACGG - Intronic
1166980264 19:46627835-46627857 CTATGGAAGGAACTGCCCTGGGG + Intergenic
925411556 2:3642754-3642776 CCATGGCAGCACCTGTCCTGTGG + Intronic
926799216 2:16644459-16644481 ACATGGCAAGGACTGTCCAGAGG - Intronic
927039977 2:19219143-19219165 CCATGTCATGACCTTCCCTGTGG - Intergenic
927146228 2:20168290-20168312 GCATGGCATGGACAGTTCTGAGG + Intergenic
927337624 2:21943353-21943375 GCATGGTATGGAGTGTCCTGTGG + Intergenic
931634794 2:64331490-64331512 CCATGGAAGGAAATGACCTGAGG - Intergenic
935733778 2:106089719-106089741 CCATGGCATCAACTGCCTAGTGG - Intergenic
937765325 2:125654340-125654362 CTATGGCATCACCTGCCCTGTGG + Intergenic
938070582 2:128306238-128306260 CCAGGGAAGGCACTGTCCTGTGG - Intronic
940001044 2:148966521-148966543 GCAGGGCATGCCCTGTCCTGTGG - Intronic
941682642 2:168415236-168415258 CCATGGCATGAGCTGTACCTTGG + Intergenic
942066535 2:172276984-172277006 CAATGGCATGAGCTGTGCTGAGG - Intergenic
942613514 2:177765789-177765811 CCATGGCCTTAACTTTCATGAGG + Intronic
943585393 2:189733123-189733145 CCTTGGCATGCATTGTCCTAGGG + Exonic
947887489 2:233585297-233585319 ACAGGGCATGAACTGTCCCCAGG + Intergenic
948726703 2:239938648-239938670 CCTTTGCATGAGCTGCCCTGGGG + Intronic
1172108664 20:32532311-32532333 CCATACCTTGAACTGTCCTCTGG + Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1173735534 20:45358814-45358836 CCATGTTATGGGCTGTCCTGAGG - Intergenic
1175956316 20:62611356-62611378 CCATGGCAGGAACTGGCCCCAGG - Intergenic
1177137236 21:17318428-17318450 CCATGGGCTGAAGTGTTCTGAGG + Intergenic
1180000012 21:44991294-44991316 CCCAGGCATCAACTGTCCAGGGG + Intergenic
1180000067 21:44991504-44991526 CCCAGGCATCAACTGTCCAGGGG + Intergenic
1182022035 22:27089515-27089537 CCATGCCAGGCACTGTCCTAGGG + Intergenic
1182816795 22:33171594-33171616 CAATGGCATGAGCTGTACTTTGG - Intronic
1183709806 22:39496308-39496330 GCAAGGAATGAACTGGCCTGCGG - Intergenic
949564600 3:5233181-5233203 TCATGATGTGAACTGTCCTGTGG + Intergenic
949770373 3:7570984-7571006 CCATGGCCTGAACTGTACCTTGG + Intronic
952847965 3:37704300-37704322 CCCTGGAATGAGCTTTCCTGAGG + Intronic
952971192 3:38651255-38651277 CCATGTCCTGAACTTTCCTGTGG - Intergenic
954760153 3:52867999-52868021 AAATGGCAGAAACTGTCCTGAGG + Intronic
957495098 3:80982255-80982277 CCATGGCATGAACTGTACCTTGG - Intergenic
959609593 3:108278516-108278538 CCATGGCCAGAACTGTACTTTGG + Intergenic
960152383 3:114263392-114263414 CCATTGGATGAAGTGTTCTGTGG + Intergenic
960695208 3:120389201-120389223 CCATGGCATGAACAGGACAGTGG - Intergenic
961450650 3:127000911-127000933 CCATGCCATGGCCTCTCCTGGGG + Intronic
965232126 3:166068182-166068204 CCATGGAATGAAAGGTTCTGTGG - Intergenic
967135410 3:186508879-186508901 CCATGGCATATTCAGTCCTGAGG + Intergenic
967613773 3:191540108-191540130 CCATGACTTAAACTGACCTGTGG + Intergenic
967827333 3:193888040-193888062 CCATGGGGTGAGCTGTTCTGGGG - Intergenic
968001183 3:195207908-195207930 CCATGATATGAGCTGCCCTGTGG - Intronic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
968653780 4:1770129-1770151 CCCTGCCATGAAGTGTCTTGGGG - Intergenic
968974141 4:3812265-3812287 CAATGGCCTGACCTCTCCTGGGG + Intergenic
969605364 4:8199697-8199719 CCTTGGCATGAGCGGCCCTGGGG + Intronic
970194818 4:13543295-13543317 CCGTGGCCTGTCCTGTCCTGTGG - Intronic
970721854 4:18997409-18997431 CCATGGCCTGAACTGTACCTTGG + Intergenic
974666565 4:64969640-64969662 CAATGGCATGAACTGTACCTTGG + Intergenic
976003958 4:80406014-80406036 TCATGACATGATCTATCCTGAGG - Intronic
976326056 4:83772874-83772896 CCATGCTGTGAGCTGTCCTGTGG - Intergenic
976915663 4:90371805-90371827 CCATGGGAAAAACTGTCCTTAGG + Intronic
978069970 4:104454847-104454869 CCATGGAATGAGCTATCTTGCGG + Intergenic
978777741 4:112520054-112520076 CCATTGCATGAACTGTCCTAAGG + Intergenic
979079943 4:116324202-116324224 CCTAGGCATGAACTAACCTGGGG + Intergenic
980654616 4:135766076-135766098 CCATGGCCTGAGCTGTACTTTGG + Intergenic
982606446 4:157522438-157522460 GCAGGGCATGAACTGAGCTGAGG + Intergenic
983049033 4:163022320-163022342 ACATGACATTCACTGTCCTGTGG + Intergenic
984167073 4:176315552-176315574 CCATTGCAGGAACTTCCCTGGGG + Intergenic
984456544 4:179976326-179976348 CCATGTTGTGAACTGTCCTGTGG - Intergenic
985889050 5:2701594-2701616 CCGAAGCATGAAGTGTCCTGTGG - Intergenic
985971362 5:3381105-3381127 CCTTGTTATGAACGGTCCTGAGG - Intergenic
987450589 5:18078794-18078816 CCATGTCATGAAGTGTTTTGGGG - Intergenic
987461980 5:18223253-18223275 CCATGGCCTGAGCTGTACTGTGG - Intergenic
987680759 5:21133431-21133453 CCATGGCCTGAACTGTACCTTGG - Intergenic
990167465 5:53010547-53010569 GCCAGGCATGATCTGTCCTGGGG - Intronic
993413209 5:87596721-87596743 CCATGGCCTGAACTGTACCTTGG + Intergenic
995019689 5:107352705-107352727 CCTTGGCCTAAACAGTCCTGGGG - Intergenic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
997375070 5:133391921-133391943 CCATGGCAGGTACAGTCTTGTGG - Intronic
1000096104 5:157972184-157972206 CCATGTCATGAACAGCCCTATGG - Intergenic
1000846012 5:166281065-166281087 CCATGTTGTGAGCTGTCCTGTGG + Intergenic
1001401029 5:171446531-171446553 GCATAGCAGGAACTGTTCTGAGG + Intronic
1003052879 6:2795988-2796010 TTCTGGTATGAACTGTCCTGAGG - Intergenic
1003633615 6:7811067-7811089 CCAAAGCATGAGCTGTCCTGAGG - Intronic
1007233910 6:40377030-40377052 CCATGACTGGAAGTGTCCTGAGG - Intergenic
1007301972 6:40874518-40874540 CCATAGCAAGAGCTGGCCTGTGG - Intergenic
1009725470 6:67531637-67531659 CCATGGCATAAACTGGCCTAGGG - Intergenic
1010385568 6:75275938-75275960 CCAAGGCATGAATAGACCTGTGG + Intronic
1011011775 6:82711371-82711393 CCAGGGCATGAACTGAGCAGAGG - Intergenic
1012074645 6:94669192-94669214 CCATGGCCTGAGCTGTACTTTGG - Intergenic
1012768272 6:103397027-103397049 CCATGGCCTGAGCTGTACTTTGG - Intergenic
1015382893 6:132589593-132589615 CCAGAGTATGTACTGTCCTGGGG + Exonic
1015902633 6:138083438-138083460 CCATGCCATGGCCTGACCTGGGG + Intergenic
1020127637 7:5541814-5541836 CCCTGGCATGCACTGTCCACTGG + Intronic
1021561053 7:21968933-21968955 CCATGACAGGAGCTGTACTGTGG + Intergenic
1024961592 7:54981952-54981974 CCATGTCCTGAGCTGCCCTGTGG - Intergenic
1028957762 7:96713066-96713088 CCATGGCCTGAACTGTACCTTGG - Intergenic
1030213285 7:107017741-107017763 CCATGCCCTGAGCTGGCCTGAGG - Intergenic
1032074342 7:128829513-128829535 CCCTGGCAGGATCTGCCCTGTGG + Intergenic
1032204875 7:129853869-129853891 CCAGGACATGTACTGTTCTGTGG - Intronic
1033867885 7:145714514-145714536 CCGTGGCCTAAAGTGTCCTGGGG - Intergenic
1040684589 8:49856704-49856726 CCATCCCAGGAACTCTCCTGTGG - Intergenic
1041890011 8:62858492-62858514 CCCTGGGATGAAGTGCCCTGGGG - Intronic
1041908882 8:63066722-63066744 GCATGGCGTGGCCTGTCCTGGGG - Intronic
1044324854 8:90847755-90847777 CCATGGCATGAACTGTATCTTGG + Intronic
1047278632 8:123425664-123425686 GCAAGGCATGAACAGCCCTGAGG - Intronic
1049255274 8:141610433-141610455 CCAGAGCCTGAACTGTCCTGGGG + Intergenic
1049305770 8:141903018-141903040 CCATGGCAGCCACTGCCCTGTGG - Intergenic
1049795954 8:144497326-144497348 CCAGGGCAAGAAGGGTCCTGGGG + Exonic
1052036960 9:23693655-23693677 TCATTGGAAGAACTGTCCTGTGG - Intronic
1052079086 9:24180662-24180684 CCATGGCCTGAGCTGTACTTTGG + Intergenic
1052156813 9:25202724-25202746 CCATGGCCTGAACTGTACCTTGG + Intergenic
1052338347 9:27341378-27341400 CAATGGCAAGCTCTGTCCTGTGG - Intronic
1052669944 9:31543878-31543900 CTATGGTATAATCTGTCCTGAGG + Intergenic
1057958515 9:99432360-99432382 CCATGCCATGAGCAGTCCTATGG - Intergenic
1059514011 9:114876112-114876134 CCATGGTCTGAGCTGTACTGTGG + Intergenic
1062267935 9:135695906-135695928 CCATGGCAGGAACTGTAATTGGG - Intronic
1188169900 X:26911647-26911669 CCATGGCCTGAGCTGTACTTTGG - Intergenic
1188538796 X:31226668-31226690 TCATGGTATGAATTGTCTTGCGG + Intronic
1189992638 X:46609238-46609260 CCTGGGCATGAACTGTGATGTGG + Intronic
1194093022 X:89601465-89601487 CTATGGCATAAAGTGTCCTTAGG + Intergenic
1195037230 X:100981194-100981216 CCATGGCCTGAAGTGCTCTGGGG - Intronic
1196285183 X:113871517-113871539 CAATGGCATGAGCTGTACTTTGG - Intergenic
1196532617 X:116806620-116806642 CCATGGGATGAAGTGCTCTGGGG - Intergenic
1196565196 X:117196788-117196810 CCATGGCCTGAACTGTACCTTGG - Intergenic
1197704995 X:129628570-129628592 CCATGTTGTGAACTGTCCTCTGG - Intergenic
1197928670 X:131673224-131673246 CTGTGCCATGTACTGTCCTGAGG + Intergenic
1198693184 X:139306763-139306785 CCATGGCTGGAAGTTTCCTGAGG + Intergenic
1199861007 X:151800593-151800615 CCATGGAATCCACAGTCCTGTGG + Intergenic
1199944915 X:152657677-152657699 CCATGGCTTCCACTGTCCTGGGG - Intergenic
1200445658 Y:3257568-3257590 CTATGGCATAAAGTGTCCTTAGG + Intergenic
1201340143 Y:12924978-12925000 CCATGGCATAAACAGGCCTAGGG - Intergenic