ID: 1165141141

View in Genome Browser
Species Human (GRCh38)
Location 19:33700663-33700685
Sequence GAACCCCCACGAAGACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 42}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165141141_1165141148 14 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141148 19:33700700-33700722 CAGCCATCATTATGCACAATTGG 0: 1
1: 0
2: 1
3: 42
4: 611
1165141141_1165141153 22 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141153 19:33700708-33700730 ATTATGCACAATTGGAGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1165141141_1165141143 -10 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141143 19:33700676-33700698 GTGGGGGTTCCTCCTAGGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 266
1165141141_1165141150 17 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141150 19:33700703-33700725 CCATCATTATGCACAATTGGAGG No data
1165141141_1165141156 27 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141156 19:33700713-33700735 GCACAATTGGAGGTGGGGAGGGG 0: 1
1: 0
2: 1
3: 51
4: 553
1165141141_1165141152 21 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141141_1165141154 25 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141154 19:33700711-33700733 ATGCACAATTGGAGGTGGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 270
1165141141_1165141151 20 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141151 19:33700706-33700728 TCATTATGCACAATTGGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 99
1165141141_1165141155 26 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141155 19:33700712-33700734 TGCACAATTGGAGGTGGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165141141 Original CRISPR GAACCCCCACGAAGACATTC TGG (reversed) Intronic
900997465 1:6130203-6130225 GAACCCGCACAATGACATCCAGG - Exonic
903846030 1:26280366-26280388 GATGCCCGATGAAGACATTCAGG - Intronic
918948867 1:191108743-191108765 GAAAACCCACAAAGATATTCAGG - Intergenic
1066274981 10:33859835-33859857 CAACCACCAGGAAGACATTCGGG - Intergenic
1066578454 10:36852491-36852513 AAACCCCCACAAAGACATAAAGG - Intergenic
1067800248 10:49353695-49353717 GACCCCCCACCAAGACAGGCTGG + Intergenic
1070212118 10:74335068-74335090 GAACCCCCAACAAAAGATTCTGG - Intronic
1079352963 11:19708513-19708535 GACCTCCCAAGAAGACAGTCCGG - Intronic
1086293184 11:85334965-85334987 GAAAACCAACAAAGACATTCAGG - Intronic
1092201678 12:6588297-6588319 GAACCCCCATAATGACATTCAGG - Exonic
1101842559 12:108339045-108339067 GAACCCTCAGGAAGACCTTCCGG - Exonic
1107285781 13:38790242-38790264 GAAACCCCACGAATAAAGTCTGG - Intronic
1123106125 14:105841807-105841829 GGACCCCCACGAGGACAGTCAGG - Intergenic
1127707211 15:61559179-61559201 GAACCACCAAGCAGACATTTTGG + Intergenic
1130139576 15:81213429-81213451 GAAAACCAACGAAGACACTCTGG - Intronic
1141308835 16:82893676-82893698 GAACTTCCTCGAAGAGATTCAGG - Intronic
1143593953 17:7903040-7903062 GAACCCCCATAATGACATCCAGG + Exonic
1150948084 17:69769369-69769391 GAACACCAACGAAGAAATTCTGG - Intergenic
1155562652 18:27095884-27095906 GAACACCAACGAAGAAATTCTGG + Intronic
1162326775 19:10004133-10004155 CAACCCCCAGGGAGACATTCAGG - Exonic
1165141141 19:33700663-33700685 GAACCCCCACGAAGACATTCTGG - Intronic
925274208 2:2637379-2637401 GAACCCCCTCGATGAGATCCAGG + Intergenic
944128465 2:196319729-196319751 GAACCCCCAAGCATTCATTCAGG - Exonic
948484318 2:238270889-238270911 GAACCCTCAGGAAGTCACTCTGG + Intronic
948523647 2:238557717-238557739 GAGGCCCCACGAGGACAGTCAGG + Intergenic
1168949079 20:1784239-1784261 GAACCCACAGGGAGACATTAGGG - Intergenic
1170902986 20:20484297-20484319 GAACACACAAGAAGACATTTAGG - Intronic
1182587569 22:31353681-31353703 CAACCTCCAGGAAGACCTTCAGG - Intergenic
1184424410 22:44400885-44400907 TAACCCACACGGAGACATTTAGG + Intergenic
954639471 3:52089437-52089459 AAACCCCCACAAAGAAGTTCAGG + Intronic
956811149 3:72865287-72865309 AAAACCCCAGGAAAACATTCTGG - Intergenic
961082328 3:124036979-124037001 GAATTCCCAAGAAGACAATCTGG - Intergenic
967243159 3:187461109-187461131 GAAGCTCCAGGAAGCCATTCTGG + Intergenic
986437122 5:7745455-7745477 GAAACCCCCTGAAGACATTGTGG + Intronic
987514542 5:18888639-18888661 GAACCCTCATGAAGACCATCTGG - Intergenic
991451509 5:66755877-66755899 GATCCTCCACGATGACATTGTGG - Intronic
1000307780 5:160011293-160011315 AAAACCCCACCAAGATATTCAGG - Intronic
1020419514 7:7985577-7985599 GAATCACAAGGAAGACATTCAGG - Intronic
1023167051 7:37353348-37353370 GAACCCCCCAGAAGAAACTCCGG - Intronic
1028164187 7:87519218-87519240 GAAGCCTCATGAAGAGATTCTGG - Intronic
1034162918 7:149005869-149005891 GGACCCCCACCAAGACCTGCGGG - Intronic
1034917127 7:155049662-155049684 GAACCCCCAGGGAGAAAGTCAGG - Intergenic
1037472661 8:19225674-19225696 AAATCCCCATGAAGAAATTCTGG - Intergenic
1039087433 8:33793890-33793912 GAACACCCAAGCAGAGATTCTGG - Intergenic
1041017350 8:53604103-53604125 GAAAACCAATGAAGACATTCAGG + Intergenic
1045739753 8:105343385-105343407 GAACCCCCAGGATAACAGTCAGG + Intronic
1048803377 8:138215837-138215859 GAAGCCCCCAGAAGATATTCTGG + Intronic
1049510529 8:143024709-143024731 GGACCCCCAGGAAGACTTGCTGG - Intergenic
1050306531 9:4311064-4311086 GAACTCCTGCGAAGACACTCTGG - Intronic
1053065646 9:35067035-35067057 GAAACCCCACAAAGACATGCAGG + Intronic
1061406081 9:130393770-130393792 GAACCACCACCACGTCATTCTGG - Intronic