ID: 1165141144

View in Genome Browser
Species Human (GRCh38)
Location 19:33700685-33700707
Sequence GATGGCTGGCCTGGCCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 277}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165141144_1165141154 3 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141154 19:33700711-33700733 ATGCACAATTGGAGGTGGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 270
1165141144_1165141152 -1 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141144_1165141161 30 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141161 19:33700738-33700760 GAGAGGGTGGCCAGAGCCCAGGG 0: 1
1: 0
2: 7
3: 71
4: 833
1165141144_1165141158 14 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141158 19:33700722-33700744 GAGGTGGGGAGGGGCAGAGAGGG 0: 1
1: 2
2: 40
3: 493
4: 3609
1165141144_1165141148 -8 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141148 19:33700700-33700722 CAGCCATCATTATGCACAATTGG 0: 1
1: 0
2: 1
3: 42
4: 611
1165141144_1165141160 29 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141160 19:33700737-33700759 AGAGAGGGTGGCCAGAGCCCAGG 0: 1
1: 0
2: 8
3: 126
4: 1282
1165141144_1165141157 13 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141157 19:33700721-33700743 GGAGGTGGGGAGGGGCAGAGAGG 0: 1
1: 2
2: 59
3: 529
4: 3495
1165141144_1165141159 17 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141159 19:33700725-33700747 GTGGGGAGGGGCAGAGAGGGTGG 0: 1
1: 3
2: 42
3: 496
4: 3560
1165141144_1165141156 5 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141156 19:33700713-33700735 GCACAATTGGAGGTGGGGAGGGG 0: 1
1: 0
2: 1
3: 51
4: 553
1165141144_1165141151 -2 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141151 19:33700706-33700728 TCATTATGCACAATTGGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 99
1165141144_1165141150 -5 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141150 19:33700703-33700725 CCATCATTATGCACAATTGGAGG No data
1165141144_1165141155 4 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141155 19:33700712-33700734 TGCACAATTGGAGGTGGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 354
1165141144_1165141153 0 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141153 19:33700708-33700730 ATTATGCACAATTGGAGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165141144 Original CRISPR GATGGCTGGCCTGGCCTAGG AGG (reversed) Intronic
900129637 1:1081935-1081957 GAGGGGTGGCCTGGCCTTCGGGG - Exonic
900335181 1:2159276-2159298 AAAGTCTGGCCTGGCCCAGGTGG + Intronic
900596795 1:3483615-3483637 GATGGCTGTCCCGGCCTAGCTGG - Intergenic
901256777 1:7835644-7835666 GATGGTTGGGCTGGCTGAGGAGG + Intronic
902046666 1:13529908-13529930 TTTGGCTGGCATGGCCTTGGTGG - Intergenic
902481099 1:16712301-16712323 TATGGCTGGCCTGGCCTGTCCGG + Intergenic
902600341 1:17536572-17536594 GAGGGCTGGCCTGGACTGTGAGG + Intergenic
902682069 1:18050579-18050601 GCTGCATGGACTGGCCTAGGGGG + Intergenic
902802278 1:18838024-18838046 CAGCGCTGGCCTGGCCTAGTGGG - Intergenic
903448532 1:23437394-23437416 GCTGGCCGGGCTGGCCGAGGGGG + Intronic
904809286 1:33152921-33152943 GCTGCCTGGCCTGGCTGAGGAGG + Intronic
905401629 1:37707885-37707907 GATGGCTGACCAGACCAAGGAGG - Intronic
906237582 1:44221284-44221306 CATTGCGGGCCTGGGCTAGGGGG - Exonic
906276877 1:44523343-44523365 GCTGGCTGGCCTGGGGTGGGAGG - Intronic
913159641 1:116133364-116133386 GATGGTTGCCCCGGCCTGGGAGG + Exonic
915676302 1:157535265-157535287 CATGCCTGGCCTGCCCAAGGGGG + Intronic
917839360 1:178964954-178964976 GGTGGCTTGGCTGGCCTAGAAGG - Intergenic
917962288 1:180154754-180154776 GGTGGCTGGGCCGGCCTCGGGGG + Intergenic
918131159 1:181630957-181630979 GCTGGCCAGCCTGGCCTGGGAGG - Intronic
920512944 1:206564317-206564339 GAGGGATGGCCTGGACTAAGCGG - Intronic
920674462 1:208029540-208029562 CAGGGCTGGCCTGGCCTGGCTGG + Intronic
924154777 1:241164447-241164469 GATGGCTGGCAGTCCCTAGGTGG - Intronic
1063103601 10:2973383-2973405 GATGGCTGCTCTGGCCTGGTTGG - Intergenic
1063391261 10:5651179-5651201 GACGGCTGGGCTGGCCCAGCTGG - Intronic
1064141989 10:12798360-12798382 TATCACCGGCCTGGCCTAGGAGG + Intronic
1064158329 10:12922342-12922364 GATGCAGGGCCTGGGCTAGGAGG - Intronic
1066756898 10:38720705-38720727 CTTGGCTGGCCTGGTGTAGGGGG + Intergenic
1067088570 10:43255256-43255278 GCTGGGCGGCTTGGCCTAGGTGG - Intronic
1067089254 10:43258304-43258326 CATGGCTGGCCTGGCCTCTCAGG + Intronic
1069638943 10:69942788-69942810 TGTGGCTGGCCTTGCCTCGGAGG - Intronic
1069907252 10:71739120-71739142 CATGGCTTGCATGGTCTAGGGGG + Intronic
1070087594 10:73252172-73252194 GCTGGCTGGACTGGCCAAGAGGG - Intronic
1070721975 10:78763200-78763222 GCTGGGTGGGCTGGCCAAGGAGG - Intergenic
1073123034 10:101133479-101133501 CAAGACTGGCCTGGCCTGGGTGG - Intronic
1073423357 10:103441678-103441700 GGGGCCTGGCATGGCCTAGGAGG + Intronic
1075558357 10:123449454-123449476 CATGGCAGGCCAGGCCGAGGTGG + Intergenic
1075573272 10:123560360-123560382 GAGGGCTGGCCTGTCTGAGGAGG + Intergenic
1075585620 10:123655938-123655960 GATGCAGGGCCTGGCCTAGCCGG - Intergenic
1076881245 10:133240214-133240236 GAAGGCCGGCCTGGGGTAGGGGG - Exonic
1077074922 11:695999-696021 GCGGCCTGGCCTGGCCTGGGTGG + Intronic
1077077822 11:709232-709254 CCTGACTGGCCTGGCCTGGGTGG - Intronic
1077217857 11:1402549-1402571 GCTGGCTGGGCTGGCCTGAGGGG - Intronic
1077284423 11:1759387-1759409 GAGGGCTGGCCTGGCTCACGGGG + Intronic
1077318127 11:1928286-1928308 CCTGGCTGGCCTGGCCCAGCTGG - Intronic
1079006301 11:16793664-16793686 CAAGGCTGGCCTGGCCCTGGAGG + Intronic
1083966543 11:66047165-66047187 AAGGGCTGGCCTGGCCTGGCTGG + Intronic
1085256259 11:75175289-75175311 CGTGGTTGGCCTGGCCCAGGAGG + Intronic
1085524177 11:77154794-77154816 CTTGGCTGGCCTGGACCAGGAGG - Intronic
1086228673 11:84542842-84542864 GGTGGCTGGCAGGGCCTAGATGG - Intronic
1087290350 11:96314261-96314283 GCTGGCTGGCCTAGCTCAGGGGG - Intronic
1087592902 11:100214947-100214969 GATGGCTGGGATGGCTCAGGGGG + Intronic
1089788338 11:120923989-120924011 GATGGCTGGCAAGTCCTGGGGGG + Intronic
1090054884 11:123414330-123414352 GATGATTGGGCTGGACTAGGTGG - Intergenic
1090258762 11:125303947-125303969 CATGGCCGGCCTGAGCTAGGAGG + Intronic
1090421774 11:126580323-126580345 CATGGCTGGGCTGGCCAGGGAGG + Intronic
1092595020 12:9993157-9993179 GAAGGCTGGCATGACCAAGGTGG - Exonic
1092599651 12:10045593-10045615 GAAAGCTGGCATGGCCAAGGTGG + Intronic
1094567920 12:31616769-31616791 GATGGCTGGCAGCCCCTAGGTGG + Intergenic
1095571185 12:43685446-43685468 GGTGGCTGGCCCGGCAGAGGGGG - Intergenic
1096002503 12:48141338-48141360 GGGGGCTGGACTGGCCAAGGTGG + Exonic
1097516724 12:60616676-60616698 GGTGGCTGGCTTGGCTTTGGTGG - Intergenic
1099298175 12:80857190-80857212 GATATCTGGCTTGGCCTAGAAGG - Intronic
1101413659 12:104490176-104490198 GATGTGTGTCCTGGCCTAGCTGG + Intronic
1102571331 12:113828707-113828729 GGGGGCTGGCCTGGCTTGGGAGG + Intronic
1103254021 12:119524652-119524674 GAGGGCTGTCCTGGGCCAGGTGG - Intronic
1103317198 12:120065585-120065607 CTTTGCTGGGCTGGCCTAGGAGG + Intronic
1105507478 13:21023027-21023049 GATTGCTGGGCTGGACTAGAGGG - Intronic
1106868658 13:33995278-33995300 GATGGCTGGGCTTGGCTGGGTGG + Intergenic
1106928228 13:34635271-34635293 AATGGTTGGCTTGGCCTAAGTGG - Intergenic
1108676257 13:52739815-52739837 GACCGCTGGGCTGGCCCAGGCGG - Intergenic
1112654364 13:101434083-101434105 GAGGGCTGGCCTGCACTAGAAGG + Intergenic
1113352501 13:109543025-109543047 GTTGGCTGGCCTGGGCTGAGGGG - Intergenic
1114711167 14:24779811-24779833 GATGGTAGGGCTGGCTTAGGAGG - Intergenic
1119667398 14:76494822-76494844 GAAGGCTGGCCAGGCCTTGGAGG + Intronic
1122069505 14:99196444-99196466 GCTGGCTGGCCTGGCTCAGGAGG - Intronic
1122930121 14:104929285-104929307 CATGGCTGGCCTGGCCTTGCAGG + Exonic
1123035641 14:105470850-105470872 GGTGGCTGTCCTGGCTGAGGTGG - Intergenic
1123441174 15:20292958-20292980 CTTGGCTGGCCTGGTGTAGGGGG + Intergenic
1123447486 15:20341374-20341396 GCTGGCTTGGCTGGCTTAGGTGG - Intergenic
1123447820 15:20342906-20342928 GCTGGCTTGGCTGGCTTAGGTGG - Intergenic
1127829702 15:62739527-62739549 GATGGCTGGCCAAGCTCAGGTGG + Exonic
1128345339 15:66849545-66849567 GAGGCCTGGCCTGGAGTAGGAGG - Intergenic
1128526616 15:68416571-68416593 GATGGCTGTCCAGGGCTCGGAGG - Intronic
1128530408 15:68441359-68441381 GGTGGCTGCCCCAGCCTAGGCGG - Intergenic
1128733178 15:70034464-70034486 GATGGCTGGCCTGTGTCAGGTGG + Intergenic
1129324864 15:74794514-74794536 GATTGATGGCCTGGCCTCTGGGG + Intronic
1129953359 15:79611438-79611460 GATGGCTGTCCTTGGCCAGGTGG - Intergenic
1130896577 15:88174731-88174753 GACAGCTGGCCTGGCTTTGGAGG - Intronic
1132347289 15:101115998-101116020 GATGCCTCGCCTGGGCCAGGCGG - Intergenic
1132349986 15:101133538-101133560 CATGGCTGGCCTGGCCCTGAAGG - Intergenic
1132697304 16:1207681-1207703 GAAGTCTGGGCTGGCCTGGGAGG - Intronic
1133218843 16:4309699-4309721 GATGGGGCGCCTGGGCTAGGGGG - Intergenic
1133317442 16:4893320-4893342 GCTGGCTGGCTTGGACAAGGTGG - Exonic
1135058472 16:19250882-19250904 GATGGCTGCCCTGGGGGAGGGGG - Intronic
1135143252 16:19939668-19939690 GATGGATGGCCTGGCATAGAAGG - Intergenic
1135528487 16:23232254-23232276 GAAGGATGGCCTGGCCTAAGAGG - Intergenic
1136022480 16:27448963-27448985 GCTGGCAGCCCTGGGCTAGGAGG + Exonic
1136270216 16:29144091-29144113 CCTGGCTGGCCTGGCCCAGGGGG + Intergenic
1136716269 16:32286306-32286328 GCTGGCTGGGCCGGCCTAGCTGG + Intergenic
1136823346 16:33338650-33338672 GATGGCTGGCTTTGGCTGGGTGG + Intergenic
1136823564 16:33339592-33339614 GATGGCTGGCTTTGGCTGGGTGG + Intergenic
1136834655 16:33492584-33492606 GCTGGCTGGGCCGGCCTAGCTGG + Intergenic
1137836252 16:51595543-51595565 GTTGGCTGGCATGGCCTGGCTGG + Intergenic
1138536853 16:57664692-57664714 GATTGCTGGCCTGTTGTAGGTGG + Exonic
1139447562 16:67007228-67007250 GGTGTCTGGCCCAGCCTAGGGGG + Intronic
1139589234 16:67924235-67924257 GAGGGCTGGCCTGGCCTCTCTGG - Intronic
1141694767 16:85614105-85614127 GATGGCTGCCCCAGCCTCGGAGG + Intronic
1141825609 16:86477506-86477528 TATGGCTGGTCTTGCTTAGGTGG - Intergenic
1142073805 16:88105925-88105947 CCTGGCTGGCCTGGCCCAGGAGG + Intronic
1203010148 16_KI270728v1_random:231448-231470 GCTGGCTGGGCCGGCCTAGCTGG - Intergenic
1203144526 16_KI270728v1_random:1791586-1791608 GCTGGCTTGGCTGGCCTGGGTGG + Intergenic
1203144734 16_KI270728v1_random:1792511-1792533 GATGGCTGGCTTTGGCTGGGTGG + Intergenic
1142808625 17:2384990-2385012 GATGGCAGGCCTGACCCACGGGG - Exonic
1143867643 17:9935642-9935664 GATGGCTGGCCAGCCCTGTGTGG + Intronic
1144725355 17:17499130-17499152 GATGGCTGACAGGGCCCAGGCGG - Intergenic
1145314523 17:21721495-21721517 GAAGACTGGCCTGGCCAACGTGG + Intergenic
1145973709 17:28972154-28972176 GACTGCTGGCCTAGCCTGGGAGG - Intronic
1146053406 17:29569020-29569042 GATGGCTGGACCGGCGGAGGAGG + Exonic
1148683855 17:49489854-49489876 GATGGCTGCCCTGGGGTATGGGG + Intergenic
1150493238 17:65588701-65588723 GAAGGCTGGCCTGGCCCTGGAGG - Intronic
1151129618 17:71882801-71882823 GAAGGCTGGGCTGGGCTAGATGG + Intergenic
1151725115 17:75878892-75878914 GAGCGCTGGCCTGGCCCAGAAGG - Intergenic
1152332929 17:79684195-79684217 GATGGCTGGCGTGGCCTTCTGGG - Intergenic
1155293760 18:24366476-24366498 GATGGCTGGCAACCCCTAGGTGG - Intronic
1156461203 18:37322315-37322337 GCTGGATGCCCTGGCCTGGGTGG - Intronic
1156479502 18:37427202-37427224 GATTGCTGGCCTGGGGTAGGAGG + Intronic
1157923087 18:51733783-51733805 TCTGGCTGGCCTGGAGTAGGGGG + Intergenic
1158708592 18:59817111-59817133 GATGGCAGGCCTGGGGAAGGTGG + Intergenic
1158725531 18:59968410-59968432 GAGGGTTGGCATGGCCTGGGTGG + Intergenic
1160008866 18:75088809-75088831 GGAGGCTGGCCTGGCCTGGGAGG + Intergenic
1160031022 18:75260126-75260148 GAGGGCAGGCCTGGCCCCGGAGG + Intronic
1160792295 19:928302-928324 GAGGTGTGGCCTGGGCTAGGGGG + Intronic
1161082787 19:2319787-2319809 GGTGGCAGGGCTGGGCTAGGTGG + Intronic
1161361420 19:3852173-3852195 GGTGGCTCTCCTGGCCAAGGCGG + Intronic
1162740479 19:12770966-12770988 GCTGACTAGCCTGGCCCAGGAGG - Exonic
1162940450 19:14006061-14006083 GGTGGCTGGCCGGGCCGGGGTGG - Intronic
1163053470 19:14702024-14702046 GATGCCTGGCATGGCCTGGAAGG - Intronic
1163317980 19:16554618-16554640 GGAGGCTGGCCTGGCCAAGATGG + Intronic
1164673575 19:30087516-30087538 GCCGGCTGGCCTGGCAGAGGGGG + Intergenic
1164929849 19:32166971-32166993 GAGGGCTTGCCTGGCAGAGGAGG - Intergenic
1165103702 19:33456375-33456397 CCTGGCTGGCCATGCCTAGGGGG - Intronic
1165141144 19:33700685-33700707 GATGGCTGGCCTGGCCTAGGAGG - Intronic
1165230360 19:34382856-34382878 GCTGTCTAGCCTGGCCCAGGAGG - Intronic
1165407423 19:35639274-35639296 GCTGGGTGGTCTGGCCCAGGTGG - Intergenic
1166844511 19:45718436-45718458 GAAGCCTGACCTGGCCTAGGGGG - Intronic
1167111722 19:47466382-47466404 CATGGCTCCCCTGGCCTTGGTGG - Exonic
1167175811 19:47863681-47863703 TGAGGCTGGCCTGGCCTAAGAGG - Intergenic
1167880041 19:52449817-52449839 GAAGCCTAGCCTGGCCAAGGTGG + Intronic
1168113715 19:54209231-54209253 GGTGGCTCGCATGGCCCAGGGGG + Intronic
925576041 2:5361135-5361157 GATGGCTGCCCTGGGCTAGGAGG + Intergenic
926289479 2:11517153-11517175 GAGGGCCAGCCTGGCCTTGGAGG - Intergenic
927109027 2:19851241-19851263 GAGGGCTGGCCTCACCTGGGAGG - Intergenic
927717181 2:25360337-25360359 GATGGTTTGCCTGGTCAAGGAGG - Intergenic
928086172 2:28347762-28347784 CAGGGCTGGCCTGGCTGAGGAGG + Intergenic
929452859 2:42048293-42048315 GGGGACTGGCCTGGCCTCGGAGG - Exonic
929517428 2:42616349-42616371 CATTGCACGCCTGGCCTAGGTGG + Intronic
929810368 2:45184558-45184580 GAGGCCTGGGCTGGCCTAGTAGG + Intergenic
932335776 2:70930656-70930678 GATGTCTGGCATGGCCCAGGTGG + Intronic
932490285 2:72115868-72115890 GATGTCTGCCCTGGAGTAGGGGG - Intergenic
932492875 2:72132751-72132773 GCAGGCTGGCCAGGCCTTGGGGG - Intronic
933963244 2:87418077-87418099 GCTGGCTGGGCTGGCTTAGCTGG - Intergenic
934320202 2:91965147-91965169 CTTGGCTGGCCTGGTGTAGGGGG + Intergenic
934558328 2:95299219-95299241 TGTGGCTGGCCTGGCCAGGGAGG + Intronic
936508349 2:113126083-113126105 GATGGCTGGGCTGGGCACGGTGG - Intronic
946021402 2:216642821-216642843 GTTGGCTGGCCAGGCAAAGGAGG - Intronic
946242901 2:218367730-218367752 GATAGCTGGCGTGGCCGAGCCGG - Exonic
947101056 2:226621708-226621730 GATGGGTGTCCTGGGCTAGGAGG - Intergenic
947812117 2:233011122-233011144 GGTTTCTGGCCTGGCCTCGGGGG + Intronic
947852421 2:233299157-233299179 GGCAGCTGGCCTGGCCTAGTGGG + Intergenic
949014938 2:241703401-241703423 GGAGGTTGGCCTGGTCTAGGGGG + Intronic
949040839 2:241849432-241849454 GAGGGCTGCCCTGGGCTATGAGG - Intergenic
1169192624 20:3667812-3667834 GCTGGCAGGCCGAGCCTAGGTGG - Intergenic
1169267456 20:4175271-4175293 GGTGGCTGGGCTGGACTGGGTGG - Intronic
1172150550 20:32787364-32787386 GCTGGCTGTCCTGGGCTAGGCGG - Exonic
1172627147 20:36353781-36353803 GATGACTGGCTTGGCCCAAGGGG + Intronic
1172700779 20:36852393-36852415 GATGGCTGCCCTGGCCTCTTGGG - Intronic
1172917016 20:38450772-38450794 ACTGGATGGCCTGGCCTAGATGG - Intergenic
1173228150 20:41174027-41174049 GTGGGCTGGCCTGGGGTAGGTGG + Intronic
1174570552 20:51498208-51498230 GATGGATGTGCTGGCGTAGGCGG - Intronic
1175907770 20:62389879-62389901 GTGGGCTGCCCTGGCCGAGGTGG + Exonic
1175917276 20:62432420-62432442 GATGGCTGTCCTCACCTCGGTGG - Intergenic
1176190684 20:63808295-63808317 GATGGCTTGACTGGCCTACAGGG - Intronic
1176332447 21:5560713-5560735 GTTGGCTGGACTGGGCTGGGGGG + Intergenic
1176395310 21:6260238-6260260 GTTGGCTGGACTGGGCTGGGGGG - Intergenic
1176441847 21:6728866-6728888 GTTGGCTGGACTGGGCTGGGGGG + Intergenic
1176466109 21:7055935-7055957 GTTGGCTGGACTGGGCTGGGGGG + Intronic
1176489670 21:7437713-7437735 GTTGGCTGGACTGGGCTGGGGGG + Intergenic
1179831749 21:44001265-44001287 GATGGCCGCCCTGGGGTAGGTGG - Intergenic
1180085633 21:45506839-45506861 AGGGGCTGGCCAGGCCTAGGAGG - Intronic
1180308454 22:11149201-11149223 CTTGGCTGGCCTGGTGTAGGGGG + Intergenic
1180546931 22:16511014-16511036 CTTGGCTGGCCTGGTGTAGGGGG + Intergenic
1180553753 22:16560229-16560251 GCTGGCTTGGCTGGCTTAGGTGG - Intergenic
1180553829 22:16560581-16560603 GCTGGCTTGGCTGGCTTAGGTGG - Intergenic
1180554735 22:16564868-16564890 GGTGGCTTGGCTGGCTTAGGTGG - Intergenic
1180554765 22:16565005-16565027 GCTGGCTTGGCTGGCTTAGGTGG - Intergenic
1180732820 22:17994620-17994642 GGGGGATGGCCTGGCCCAGGAGG + Intronic
1181051146 22:20238846-20238868 GATGCCTGGCCAGCCCCAGGGGG - Intergenic
1181775294 22:25154815-25154837 CATGGCTGGCCTGGCAGAGCTGG - Intronic
1181921594 22:26325005-26325027 GTTGGCTGTCGTGGTCTAGGTGG + Intronic
1182120652 22:27784240-27784262 CAGGCCTGGCCTGGCCTGGGAGG - Intronic
1182212246 22:28686341-28686363 CTTGGCTGGCCTGGTGTAGGGGG - Intergenic
1182578442 22:31289671-31289693 GAAGGCTGGCAGGGCCTGGGAGG + Exonic
1183166998 22:36155620-36155642 GACAGCTGCCCTGGCCTAGGGGG - Intronic
1183172971 22:36201594-36201616 GATGGTTGCCTTGGCCTAGGGGG - Intronic
1183294773 22:37022994-37023016 GTGGGCTGGCCTGGCATAGTGGG + Intronic
1184465525 22:44667336-44667358 GAGGGATGTCCTGGCCTTGGAGG - Intergenic
1184690992 22:46117186-46117208 CATGGCAGGCCTGTCCTTGGTGG - Intergenic
1184691257 22:46118336-46118358 CATGGCGGGCCTGTCCTTGGTGG + Intergenic
1185235287 22:49708908-49708930 GATGGCTGGCATCCCCTAGGTGG - Intergenic
949892277 3:8742223-8742245 GAGGGCTGGGCTGGGCTTGGAGG - Intronic
950507812 3:13406589-13406611 GCTGGCTGACCTGGCTTCGGTGG - Intronic
950558264 3:13707867-13707889 GAAGGCTGGCCTGCCATTGGGGG + Intergenic
951433110 3:22631038-22631060 CATGGCTGTCATGGACTAGGTGG - Intergenic
953232373 3:41076312-41076334 GAGGGCAGGCCTGGCCTCTGGGG + Intergenic
953240455 3:41144220-41144242 GATGGGTGGGGTGGCATAGGGGG - Intergenic
953385510 3:42503592-42503614 GATGGCTTACCTGGGCTGGGAGG + Intronic
955075431 3:55608877-55608899 GAAGGCTGGCATGGACTAGCAGG + Intronic
956040152 3:65137125-65137147 GATGGGTGGCTTGGCATGGGAGG - Intergenic
956751132 3:72344872-72344894 AGTGGCTGGCCTGGCCTGCGGGG - Intergenic
959105072 3:102056487-102056509 GATGGTTGGCAGGGCCTAGGGGG - Intergenic
960019473 3:112932780-112932802 GACTGCTGGGCTGGCCTGGGGGG - Intronic
961321301 3:126078261-126078283 AATGGCTGGTCTGGCCTGAGGGG - Intronic
962463490 3:135635984-135636006 GATGGCTGGCTGGGTCTGGGTGG + Intergenic
963138773 3:141930977-141930999 GAGGGCCGGCCTGGCCCAGCTGG - Intergenic
966719207 3:183044718-183044740 GCTGGCTGCCCGGGCCTAGGGGG + Intronic
966878869 3:184338593-184338615 GCTGGCTGGCCAGGCGTGGGTGG - Intronic
968916059 4:3497531-3497553 GACGGCTGGCCTGGGGTAGATGG + Intronic
968962693 4:3753376-3753398 GATGGCTGGGCTGTTCTTGGCGG + Intergenic
969264458 4:6055805-6055827 GAGGGCTGGCCTGTCCTCTGGGG - Intronic
969264501 4:6055969-6055991 GAGGGCTGGCCTGTCCTCTGGGG - Intronic
969301828 4:6301514-6301536 GGTGGCCGGCCTGGCCCTGGTGG + Exonic
971012904 4:22458769-22458791 GCTGGCTGGTCTGGGGTAGGTGG - Intronic
971496657 4:27273933-27273955 GATGGCAGGCCTGGTCTTGTTGG + Intergenic
972688460 4:41373446-41373468 CATGGCTGGCCTTGTCTGGGAGG + Intronic
972702734 4:41509643-41509665 GAAGATTGGCCTGGCTTAGGTGG + Intronic
975443791 4:74439963-74439985 GATAGCTGGCCTTGCCCAGAAGG - Intergenic
976596133 4:86896948-86896970 GATGGCTAGCATGGAGTAGGTGG - Intronic
978501138 4:109411029-109411051 GAAGTCTTGCCTGGCCTACGTGG + Intergenic
979601204 4:122588087-122588109 GATGTCTGGCCTGAACTAGGAGG - Intergenic
981696011 4:147559464-147559486 GGTGGCTGGCCTGGTCTGGTGGG - Intergenic
985531930 5:438892-438914 GAGGGCTGGCCTGGTCCTGGGGG - Intergenic
985680362 5:1252829-1252851 GATGGAGGGCCTGGCCAGGGTGG - Intergenic
985888233 5:2696652-2696674 CATGGCTGCCCTGGCCATGGAGG + Intergenic
986143571 5:5054994-5055016 TATGGCTGGCCTGGCAGAGTAGG - Intergenic
988993599 5:36693795-36693817 GATGGCTGGGCAGGGCAAGGTGG - Intergenic
992845537 5:80743284-80743306 GATGGCTGGACAGGCTAAGGAGG - Intronic
995714347 5:115067562-115067584 AATGCCTGTCCTGCCCTAGGAGG - Intergenic
996005215 5:118412206-118412228 TATGGTTGGCCTGGCACAGGTGG + Intergenic
997204003 5:132030810-132030832 GCTGGCTGTCCTGGTCTAAGTGG + Intergenic
1000095631 5:157968738-157968760 GATGGCTAGCTTGGGCTCGGAGG - Intergenic
1002466204 5:179410120-179410142 TCTGGCTGGCCAGGCCTGGGTGG + Intergenic
1003034834 6:2633448-2633470 GAGGAGTGGCCTGGCCTAGAGGG - Intronic
1004909743 6:20271465-20271487 GGTGGCTGGGCTTGCCTTGGTGG - Intergenic
1007464025 6:42039433-42039455 GGTGGCAGCCCTGGCCTAGAGGG - Intronic
1007602934 6:43094799-43094821 GATTGCTGGCCAGGCCACGGTGG + Intronic
1007716202 6:43857633-43857655 GAGGGCTGTCCTGCCCCAGGGGG + Intergenic
1017656462 6:156634048-156634070 GATGGCTGCTCTGGCAGAGGAGG - Intergenic
1018247212 6:161834800-161834822 AATGGTTGCCCTGGCCTGGGAGG - Intronic
1019280805 7:199078-199100 GAGGGCTGGCCTAGGCCAGGAGG + Intronic
1019442233 7:1053210-1053232 GGAGCCTGGCCTGGCCCAGGCGG - Intronic
1019501730 7:1368262-1368284 GATGGCTCTCCAGGCCTTGGTGG + Intergenic
1019635967 7:2075890-2075912 GATGCCTGCCCTTGCCTTGGCGG - Intronic
1021289501 7:18825228-18825250 GACTGGTGGCCTTGCCTAGGAGG + Intronic
1022887184 7:34658402-34658424 GTTGGCTGGCATGGCTCAGGCGG - Exonic
1023293740 7:38693138-38693160 GTAGACTGCCCTGGCCTAGGAGG + Intergenic
1024068905 7:45769297-45769319 TATGTCTGGCGTGGCCGAGGCGG + Intergenic
1026875461 7:73876850-73876872 TATGGCTGGGATGGGCTAGGGGG - Intergenic
1027755411 7:82204799-82204821 TATGTCTGCCTTGGCCTAGGGGG + Intronic
1029544378 7:101202533-101202555 GGTGGCTGTCCTGGCGTGGGAGG - Intergenic
1031162458 7:118184326-118184348 GTTGGGAGGCCTGGCCTCGGCGG + Intronic
1033658264 7:143387569-143387591 GAAGGTTGGGCTGGCCTAGGGGG + Intronic
1034399441 7:150852428-150852450 GAGGCCTGAGCTGGCCTAGGAGG - Intronic
1034900173 7:154903412-154903434 GAGGGCTGGCTTGGCCTGGGAGG + Intergenic
1036688178 8:10925303-10925325 GCTGGCTGGCCATGCCCAGGTGG + Intronic
1037548644 8:19948519-19948541 GAAGGCTGGCACTGCCTAGGGGG - Intronic
1037886698 8:22599522-22599544 GGTGGGGGGCGTGGCCTAGGGGG - Intronic
1038534651 8:28345084-28345106 GCTGGCAGAGCTGGCCTAGGTGG - Intergenic
1040977154 8:53206135-53206157 GATGGCTGGCAGTGCCTAGCTGG - Intergenic
1042871865 8:73406862-73406884 GACAACTGGCCTGGCCTAGAAGG + Intergenic
1044611662 8:94098049-94098071 GATGGCACGCTTGGCCTGGGTGG - Intergenic
1045486388 8:102634807-102634829 GGTGGATGTGCTGGCCTAGGAGG + Intergenic
1048996917 8:139800240-139800262 GAATGCTGTCCTGGCATAGGTGG - Intronic
1049097901 8:140559604-140559626 CATGGCTGGCCTGGCCTATGAGG - Intronic
1049262677 8:141648117-141648139 GATGGCTCTCCTGGCTCAGGTGG - Intergenic
1049526699 8:143130461-143130483 GGAGGCAGGCCTGGCCTATGAGG + Intergenic
1049535387 8:143178090-143178112 TCTGGCTGGCCTGGCATAGTTGG + Intergenic
1049675064 8:143885649-143885671 GATGCCAGGCCTGCCCTGGGAGG + Intergenic
1050382302 9:5042675-5042697 GAGGGCAGGCCTGGCCTGGAGGG + Intronic
1054918907 9:70522419-70522441 GATTGCTTGCCTGGTGTAGGGGG - Intergenic
1057130572 9:92651559-92651581 GAGGGAGGGCCTGGCCCAGGAGG - Intronic
1057209036 9:93189636-93189658 GGTGGCTGGGCTGTCCTTGGAGG - Intronic
1060213756 9:121726061-121726083 GATGGCTGGCAGCCCCTAGGTGG + Intronic
1060947060 9:127575937-127575959 AATGGCAGGCCTGACCTAGTAGG - Intronic
1061120166 9:128637096-128637118 TAAGGGTGGCCTGGCCTAGGTGG - Intronic
1061266281 9:129507015-129507037 GGTCCCTGGCCTGGTCTAGGTGG - Intergenic
1061623063 9:131824246-131824268 GAATGGTGGCCTGGCCGAGGAGG - Intergenic
1203429646 Un_GL000195v1:79619-79641 GTTGGCTGGACTGGGCTGGGGGG - Intergenic
1187862864 X:23698380-23698402 GATGGCTGGGCTCACCTGGGAGG - Intergenic
1190797541 X:53759238-53759260 GTTGGCTGGGCTGTCCCAGGTGG + Intergenic
1190917603 X:54821882-54821904 GTTGGCTGGGCTGTCCCAGGTGG - Intergenic
1190931405 X:54951854-54951876 GTTGGCTGGGCTGTCCTAGGTGG - Intronic
1195269995 X:103220057-103220079 GCTGGCTGTCCTGGCCTATATGG - Intergenic
1195943228 X:110182309-110182331 GAAGCCTTGCCTGGCCTGGGTGG - Intronic
1197074799 X:122341295-122341317 TATCACAGGCCTGGCCTAGGAGG - Intergenic
1201187722 Y:11420256-11420278 CTTGGCTGGCCTGGTGTAGGCGG + Intergenic