ID: 1165141145

View in Genome Browser
Species Human (GRCh38)
Location 19:33700688-33700710
Sequence AATGATGGCTGGCCTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 292}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165141145_1165141151 -5 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141151 19:33700706-33700728 TCATTATGCACAATTGGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 99
1165141145_1165141154 0 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141154 19:33700711-33700733 ATGCACAATTGGAGGTGGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 270
1165141145_1165141161 27 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141161 19:33700738-33700760 GAGAGGGTGGCCAGAGCCCAGGG 0: 1
1: 0
2: 7
3: 71
4: 833
1165141145_1165141159 14 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141159 19:33700725-33700747 GTGGGGAGGGGCAGAGAGGGTGG 0: 1
1: 3
2: 42
3: 496
4: 3560
1165141145_1165141152 -4 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141145_1165141158 11 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141158 19:33700722-33700744 GAGGTGGGGAGGGGCAGAGAGGG 0: 1
1: 2
2: 40
3: 493
4: 3609
1165141145_1165141157 10 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141157 19:33700721-33700743 GGAGGTGGGGAGGGGCAGAGAGG 0: 1
1: 2
2: 59
3: 529
4: 3495
1165141145_1165141153 -3 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141153 19:33700708-33700730 ATTATGCACAATTGGAGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1165141145_1165141150 -8 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141150 19:33700703-33700725 CCATCATTATGCACAATTGGAGG No data
1165141145_1165141155 1 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141155 19:33700712-33700734 TGCACAATTGGAGGTGGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 354
1165141145_1165141156 2 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141156 19:33700713-33700735 GCACAATTGGAGGTGGGGAGGGG 0: 1
1: 0
2: 1
3: 51
4: 553
1165141145_1165141162 28 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141162 19:33700739-33700761 AGAGGGTGGCCAGAGCCCAGGGG 0: 1
1: 0
2: 4
3: 87
4: 781
1165141145_1165141160 26 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141160 19:33700737-33700759 AGAGAGGGTGGCCAGAGCCCAGG 0: 1
1: 0
2: 8
3: 126
4: 1282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165141145 Original CRISPR AATGATGGCTGGCCTGGCCT AGG (reversed) Intronic
900269652 1:1780633-1780655 AGTTATTGCTGGCCAGGCCTGGG - Intergenic
900313323 1:2045061-2045083 CCTGCTGGCTGTCCTGGCCTCGG - Intergenic
900528843 1:3142821-3142843 ACTGATGGATGGCCTTGGCTGGG + Intronic
901068979 1:6507940-6507962 AGAGATGGCTGGCCAGGCCATGG - Intronic
901196224 1:7441499-7441521 ACTGCGGGATGGCCTGGCCTCGG - Intronic
901256776 1:7835641-7835663 AATGATGGTTGGGCTGGCTGAGG + Intronic
902159252 1:14516416-14516438 AATGCTGGTTGACCAGGCCTAGG - Intergenic
902941717 1:19804858-19804880 CGTGAGGGCTGGCCCGGCCTGGG + Intergenic
904063779 1:27732021-27732043 CATGTTGGCTGGGCTGGTCTCGG + Intronic
904603920 1:31688816-31688838 AAGGATGGCTGAACTGGGCTGGG + Intronic
905103210 1:35544011-35544033 AATGCAGGCTGACCTGGCATGGG + Intronic
905250327 1:36644191-36644213 AATGCTGGCTGGCCTGAGCCAGG + Intergenic
905812235 1:40921173-40921195 AATGATAGCATGACTGGCCTTGG - Intergenic
906684970 1:47757390-47757412 AATGAAGGCTGGGATGGGCTGGG - Intergenic
907720674 1:56969152-56969174 AATGGGTGCTGGCCTTGCCTTGG + Intergenic
907861409 1:58357213-58357235 AATGATGAGTGGCTTGGGCTAGG + Intronic
912500838 1:110121083-110121105 AATGAGGGCTGGGCTGGCAGGGG - Intergenic
913647707 1:120875972-120875994 CATGAAGTCTTGCCTGGCCTAGG - Intergenic
914078927 1:144386876-144386898 GATGAAGTCTTGCCTGGCCTAGG + Intergenic
914100252 1:144579626-144579648 GATGAAGTCTTGCCTGGCCTAGG - Intergenic
914173831 1:145255420-145255442 GATGAAGTCTTGCCTGGCCTAGG + Intergenic
914298740 1:146358056-146358078 GATGAAGTCTTGCCTGGCCTAGG + Intergenic
914528492 1:148496608-148496630 GATGAAGTCTTGCCTGGCCTAGG + Intergenic
914637899 1:149570499-149570521 GATGAAGTCTTGCCTGGCCTAGG - Intergenic
914792079 1:150887011-150887033 AATGGTGGCTGTCCTGGCCCTGG + Intergenic
917081866 1:171263816-171263838 ATTGAAGGCTGGCAGGGCCTGGG + Intronic
918315523 1:183319548-183319570 GCTGAAGGCAGGCCTGGCCTTGG - Intronic
919452426 1:197787816-197787838 AATGGGAGCTGGCCTGGACTTGG + Intergenic
919782025 1:201227211-201227233 AATGGTGGCTGCCCTGGCAGTGG + Intronic
921031189 1:211336445-211336467 CATGATGGCTGACCTGGGGTAGG - Intronic
921933372 1:220773538-220773560 AAGCATGGGTGGCCTGGACTTGG + Intronic
922598335 1:226831017-226831039 AATGATGGCTGCCAGGGGCTGGG + Intergenic
923262890 1:232284245-232284267 ACTGATGGCTTGCCTGGCAGTGG - Intergenic
923870996 1:237994100-237994122 TATTAAGGCTGGCCTGGCCTGGG - Intergenic
924813658 1:247424612-247424634 ACTGAAGGCTGCCCTGGCTTGGG - Exonic
1063936340 10:11082432-11082454 ACTGATGGCTGGCCTGGGTGAGG + Intronic
1067164675 10:43855875-43855897 GATGCTGGCCAGCCTGGCCTGGG + Intergenic
1067165549 10:43863918-43863940 ACTGATGGCTGGCCCAGCCCAGG + Intergenic
1067778046 10:49177075-49177097 AAGGAAGCCAGGCCTGGCCTGGG + Intronic
1069896303 10:71682340-71682362 AGTTATGGCTGGCATGGCCCGGG - Intronic
1069965382 10:72110865-72110887 AATAATGGCTGGCCTTGGATTGG + Intronic
1070797222 10:79223782-79223804 ACTGGTGGGTGGCCTGGCCTGGG + Intronic
1073232381 10:101983121-101983143 ACTGACGGCTGGCCTCCCCTAGG + Intronic
1073729605 10:106272567-106272589 AAGGATGGCTGGCCTGCCTCCGG + Intergenic
1075552077 10:123400189-123400211 AATGAGGGCTCTGCTGGCCTAGG + Intergenic
1075994789 10:126868566-126868588 AATGATGGCTGCCAGGGGCTGGG + Intergenic
1076033639 10:127180309-127180331 CATGATGGCTTGCCTTGGCTGGG + Intronic
1076543880 10:131231088-131231110 CATGTTGGCCGGCCCGGCCTGGG + Intronic
1076783147 10:132735527-132735549 AACCACGGCTGGCCTGGCTTTGG + Intronic
1077475631 11:2789013-2789035 CATCATGGCTTGCCTGGCCAGGG + Intronic
1077733296 11:4759834-4759856 GAGGATGGCTGTCCTGGTCTTGG + Intronic
1077836192 11:5929826-5929848 AAGGAGTGCCGGCCTGGCCTGGG - Intronic
1078217116 11:9320840-9320862 AATGTTGGCTGGGCTGGGCGTGG - Intergenic
1078443652 11:11387808-11387830 AATGATGGTGAGCCTGGCTTGGG + Intronic
1081760806 11:45575383-45575405 AAAGATGAATGGCCTGGCCAAGG + Intergenic
1082126492 11:48437279-48437301 AATGATGGTTGCCAGGGCCTGGG - Intergenic
1082788584 11:57331590-57331612 TAGGAAGGCTGGCGTGGCCTGGG - Intronic
1083452939 11:62758227-62758249 ACTGATGGCTGGCAGGCCCTAGG - Intergenic
1083738535 11:64695261-64695283 AATGATGGATGGCATTGCCATGG + Intronic
1083943517 11:65911510-65911532 AAGGCTGGCAGGCCTGGGCTGGG + Intergenic
1084020061 11:66411918-66411940 AATGATGGCTGGCATGTCATAGG + Intergenic
1088214211 11:107490300-107490322 AATAAGGGCTGGCGAGGCCTGGG + Intergenic
1088893737 11:114062852-114062874 AATGAATGTTGGCCTTGCCTAGG + Intronic
1089640343 11:119843722-119843744 ACTGCCAGCTGGCCTGGCCTGGG + Intergenic
1091160017 11:133411492-133411514 AGTTAGGGCTGGCCAGGCCTGGG - Intronic
1091223443 11:133944349-133944371 CATGAAGACTGGCCCGGCCTGGG + Exonic
1092761815 12:11817687-11817709 CATGGGGGCTGGCCAGGCCTCGG - Intronic
1096239641 12:49952895-49952917 GATGATAGCTGGCCTGGCACAGG - Intronic
1096646938 12:53043927-53043949 AATGAGGGCTGACCAGTCCTGGG - Intergenic
1096842244 12:54386561-54386583 CATTAAGGCTGCCCTGGCCTTGG - Intronic
1097021770 12:56025835-56025857 AAAGATGTCTGGCTTGGCCCTGG - Intronic
1099439555 12:82684753-82684775 AATGAAGGCTTGGCTGGCCATGG + Intergenic
1100176571 12:92037574-92037596 GAAGAGTGCTGGCCTGGCCTAGG + Intronic
1103139757 12:118538231-118538253 AACAAGGGCTGGCTTGGCCTAGG - Intergenic
1103309608 12:119994184-119994206 AATGAGAATTGGCCTGGCCTGGG - Intronic
1103322952 12:120102319-120102341 CATGAGGGCTTGCCTCGCCTGGG + Intronic
1103371962 12:120425940-120425962 AATGAAGGCTGGCCAGGGCCAGG - Intergenic
1103380646 12:120491575-120491597 AGTGATTGCTGGACTGGGCTGGG + Intronic
1103964537 12:124630412-124630434 GATGATGGCTTTCCTGGGCTGGG + Intergenic
1105620685 13:22063068-22063090 AATGTGGACTGGCCTGGACTTGG + Intergenic
1105821300 13:24083414-24083436 AAGGAGGGCAGGCCTGACCTTGG + Intronic
1108408980 13:50129290-50129312 AATGATGCTTTGCCTGGGCTAGG + Intronic
1109275921 13:60304391-60304413 ACTGATGGCTGCCCAGGGCTGGG - Intergenic
1109779679 13:67092871-67092893 TCTGATGGCTGGCTGGGCCTCGG - Intronic
1112123063 13:96434416-96434438 ACTGATGGCTGCCTTGGCCCTGG + Intronic
1113813976 13:113159105-113159127 ATTCCTGGCTGGCCTGGCCAAGG - Intronic
1114612724 14:24052857-24052879 AGTGCTGGGTGGCCGGGCCTGGG - Intronic
1116349454 14:43841667-43841689 AATGATGGTTGTCATGGGCTGGG - Intergenic
1118003928 14:61548372-61548394 AAAGAAGCCTGGCCTGGCCTGGG - Intronic
1118463661 14:66011675-66011697 CAGGAGGGCTGGCCTGTCCTGGG - Intergenic
1119650786 14:76381376-76381398 AATAATGGCAGGGCTGTCCTGGG + Intronic
1119667397 14:76494819-76494841 CAGGAAGGCTGGCCAGGCCTTGG + Intronic
1119890919 14:78181510-78181532 AAAGCTGGTTTGCCTGGCCTGGG + Intergenic
1121019466 14:90570337-90570359 AGTGTTTGCTGGCTTGGCCTTGG - Intronic
1121036131 14:90705239-90705261 GATGATGGCTGACCTTTCCTGGG - Intronic
1121568040 14:94925413-94925435 ACTGGTGCCTGCCCTGGCCTGGG - Intergenic
1122131832 14:99608587-99608609 AATGGTGGCTGACCAGGTCTGGG + Intergenic
1122732989 14:103815552-103815574 CATGTTGGCTGGGCTGGTCTTGG - Intronic
1123473439 15:20571039-20571061 AAGGATGGCTGAACTGGCCGAGG + Intergenic
1123644570 15:22429314-22429336 AAGGATGGCTGAACTGGCCGAGG - Intergenic
1123665887 15:22609222-22609244 AAGGATGGCTGAACTGGCCAAGG - Intergenic
1123702530 15:22926187-22926209 TTTGAAGGCTGGCCTGGCTTTGG - Intronic
1123733736 15:23166050-23166072 AAGGATGGCTGAACTGGCCGAGG + Intergenic
1123751867 15:23363425-23363447 AAGGATGGCTGAACTGGCCGAGG + Intronic
1124284233 15:28387349-28387371 AAGGATGGCTGAACTGGCCGAGG + Intronic
1124298464 15:28524265-28524287 AAGGATGGCTGAACTGGCCGAGG - Intronic
1124319711 15:28703635-28703657 AAGGATGGCTGAACTGGCCAAGG - Intronic
1124482801 15:30091795-30091817 AAGGATGGCTGAACTGGCCAAGG + Intronic
1124489254 15:30143866-30143888 AAGGATGGCTGAACTGGCCAAGG + Intronic
1124754274 15:32394458-32394480 AAGGATGGCTGAACTGGCCAAGG - Intronic
1125765696 15:42134092-42134114 AATGATGGCTGGCCTGCAGGTGG - Intergenic
1125969032 15:43897149-43897171 AATGATGGCTGTCCCACCCTTGG - Intronic
1126709900 15:51443794-51443816 TATGGTGTCTGGCCTGGCATTGG + Intergenic
1126964681 15:54038331-54038353 CATGTTGGCTGGGCTGGTCTGGG + Intronic
1127435492 15:58953549-58953571 ACTGATAGCTGGCCTCCCCTAGG + Intronic
1127991652 15:64123227-64123249 AATGGAGCCTGGCCTGGCTTTGG + Intronic
1128326925 15:66729848-66729870 AATGCTGACTGGCCCGGCCGCGG - Intronic
1128453881 15:67822218-67822240 AATAATGGCAGGGATGGCCTGGG - Intronic
1131820980 15:96273292-96273314 AATGCTGGCAGGCCTGGTGTTGG - Intergenic
1132184393 15:99791324-99791346 AAGGATGGCTGAACTGGCCCAGG + Intergenic
1132432585 15:101773341-101773363 AAGGATGGCTGAACTGGCCCAGG - Intergenic
1133031465 16:3013223-3013245 ACTGAGGACTGGCCTGGCTTGGG + Exonic
1133972780 16:10579551-10579573 AATGATGGTTGCCAGGGCCTGGG - Intronic
1136331298 16:29578837-29578859 TATGTTGTCTGGACTGGCCTAGG - Intergenic
1136445935 16:30318582-30318604 TATGTTGTCTGGACTGGCCTAGG - Intergenic
1137048642 16:35690236-35690258 TATGATGTCTGGGGTGGCCTAGG + Intergenic
1137830563 16:51539452-51539474 GCTGGTGACTGGCCTGGCCTTGG - Intergenic
1137855265 16:51788547-51788569 ACTGGTGGCTGGCTTGTCCTTGG + Intergenic
1138057148 16:53847244-53847266 AAGGAGGGCTGGCCTGACATGGG - Intronic
1138394311 16:56692245-56692267 CATCATGCCTGGCCTTGCCTTGG - Intronic
1138670110 16:58607263-58607285 AAAGATGGCTGGCCAGGACTAGG + Intronic
1138899874 16:61256100-61256122 AATGCTGGCTGCCCTGGTGTGGG - Intergenic
1139112080 16:63904329-63904351 AATGGGGGCTGGCCTGGCACTGG + Intergenic
1140145577 16:72303832-72303854 AATGATGGGTGGCTTGAACTAGG + Intergenic
1142287044 16:89175726-89175748 ACAGATGGCGGCCCTGGCCTCGG - Intronic
1143478066 17:7214304-7214326 AATGAGGGCGGGGCTGACCTGGG - Intronic
1143504068 17:7354269-7354291 ACTGATGGCAGGGCTGGCCAGGG + Exonic
1143673882 17:8416201-8416223 AATGATGGTTGCCAGGGCCTGGG - Intronic
1144097122 17:11909920-11909942 AATGATGGCTGACTAGGCCTGGG - Intronic
1145102508 17:20088710-20088732 AATGACGGCTTGCCTGAGCTCGG - Intronic
1145973710 17:28972157-28972179 AAGGACTGCTGGCCTAGCCTGGG - Intronic
1146109507 17:30075522-30075544 ATCGAGGGATGGCCTGGCCTGGG - Intronic
1147264777 17:39227940-39227962 AGGGAAGGCTGGACTGGCCTGGG - Intergenic
1148049532 17:44762613-44762635 CATGCTGGCTGGCAGGGCCTGGG + Intronic
1150017707 17:61575100-61575122 TGTGCTGGCTGGCCGGGCCTAGG - Intergenic
1153832086 18:8932772-8932794 AGTATTGGCTGGCCTGACCTGGG - Intergenic
1155283718 18:24267608-24267630 AAAGATGGCTGGCTTGGCACTGG + Intronic
1157442664 18:47722453-47722475 TGTGATATCTGGCCTGGCCTGGG - Intergenic
1160008865 18:75088806-75088828 CAAGGAGGCTGGCCTGGCCTGGG + Intergenic
1160031021 18:75260123-75260145 AATGAGGGCAGGCCTGGCCCCGG + Intronic
1162645642 19:12048221-12048243 AAATATGGCAGGCCTGGGCTGGG + Intronic
1162654281 19:12117047-12117069 AATCATGCCTGACCTGGTCTTGG + Intronic
1162705512 19:12551897-12551919 ACTGTGGTCTGGCCTGGCCTGGG - Intronic
1162736059 19:12747743-12747765 GACTGTGGCTGGCCTGGCCTAGG + Intronic
1162825598 19:13249673-13249695 GATGAAGCCTGGCCTGGCATGGG - Intronic
1165141145 19:33700688-33700710 AATGATGGCTGGCCTGGCCTAGG - Intronic
1166824849 19:45602256-45602278 AATGGGGGCGGGCCTGGCCGGGG - Intergenic
1166893283 19:46007775-46007797 CATTCTGGTTGGCCTGGCCTGGG - Intronic
1167203290 19:48082698-48082720 CATGTTGGCTGGGCTGGTCTCGG + Intronic
925079536 2:1052786-1052808 AATGCTGGGTGGCCTACCCTGGG + Intronic
925437889 2:3857021-3857043 CATGGTGGCTGGCCTTTCCTGGG + Intergenic
926032611 2:9605511-9605533 AATGATGGCTGCCTTGGGCAGGG - Intronic
926441389 2:12892424-12892446 AGTGATGGCTGGCATGGGCCTGG - Intergenic
927109028 2:19851244-19851266 GATGAGGGCTGGCCTCACCTGGG - Intergenic
927824086 2:26295375-26295397 AATGATGGCTGCCAGGGGCTTGG + Intergenic
931807941 2:65826103-65826125 AAGAATGGCTGGACTGGGCTGGG + Intergenic
933688663 2:85162450-85162472 AATAAGGGGTGGCCTGGCTTGGG - Intronic
934553172 2:95274517-95274539 AAGGATGTATGGCCTGCCCTGGG + Exonic
936508350 2:113126086-113126108 AATGATGGCTGGGCTGGGCACGG - Intronic
936514629 2:113174019-113174041 AAGAATGGATGGCTTGGCCTGGG - Exonic
937059693 2:118971792-118971814 GATGATGCCTGGTCTGGCCTGGG - Intronic
937062927 2:118993516-118993538 AGTGAAGGCTGGCCTGGCTTCGG + Intronic
937302387 2:120851291-120851313 CATGATGGCTAGGCTGGGCTGGG + Intronic
938039978 2:128067761-128067783 AATGATGCTTGGCCTGTACTTGG - Intergenic
938733391 2:134163903-134163925 CATGAAGGCTGGCTTGTCCTGGG + Intronic
939151729 2:138481242-138481264 AATGATGGTTGGCAGGGGCTGGG - Intergenic
939755886 2:146109870-146109892 AGGGTTGGCTGGCCTGACCTAGG - Intergenic
940256981 2:151741562-151741584 CAAGATGGCTGCCCTGGCCCAGG - Intergenic
946073830 2:217057230-217057252 ACTGATGGATGGACTGTCCTTGG + Intergenic
946944835 2:224810313-224810335 AAAGATGGCTGCCATGGGCTGGG + Intronic
947003725 2:225487173-225487195 AGTAAATGCTGGCCTGGCCTTGG + Intronic
947065189 2:226216768-226216790 AAAGATGGCGAGCCTGGCCTAGG + Intergenic
947717747 2:232350383-232350405 AGTGGTGGTTGGCCTGGCCCAGG + Intergenic
947728854 2:232417235-232417257 AGTGGTGGTTGGCCTGGCCCAGG + Intergenic
948221614 2:236274263-236274285 AATCATGGCTGGGGAGGCCTTGG + Intergenic
1168895134 20:1319105-1319127 AACTATGGCTGGCCTGGGGTGGG - Intronic
1170730530 20:18971031-18971053 AAGTATGGCTGACCTGGGCTGGG - Intergenic
1171210671 20:23314562-23314584 GCTGATGGCTGGGCTGGGCTGGG + Intergenic
1171347756 20:24478766-24478788 CATGACTCCTGGCCTGGCCTAGG - Intronic
1172937519 20:38630939-38630961 ACTGAGGGCTGCCCTGGCCCAGG + Intronic
1173198979 20:40939902-40939924 AATGGTGGCTGCCCGGGGCTGGG - Intergenic
1180087538 21:45514675-45514697 ATTCAGGGCCGGCCTGGCCTGGG - Exonic
1182120653 22:27784243-27784265 ACTCAGGCCTGGCCTGGCCTGGG - Intronic
1183454656 22:37915846-37915868 TATGATGGCCGGTCTGGTCTGGG + Intronic
1184690993 22:46117189-46117211 AAACATGGCAGGCCTGTCCTTGG - Intergenic
1184691256 22:46118333-46118355 AAACATGGCGGGCCTGTCCTTGG + Intergenic
950455864 3:13092436-13092458 AATGAGGCCTGGGCAGGCCTGGG - Intergenic
950507388 3:13403768-13403790 AAAGCAGCCTGGCCTGGCCTGGG + Intronic
950640669 3:14346240-14346262 AAATATGGCTGCCCTGGCTTGGG - Intergenic
952388589 3:32860747-32860769 CAGGCTGCCTGGCCTGGCCTGGG + Intronic
954151973 3:48662399-48662421 GAGGATGGGGGGCCTGGCCTGGG - Exonic
954415374 3:50390875-50390897 AGTCATGTCTGGCCAGGCCTTGG - Intronic
959105075 3:102056490-102056512 AATGATGGTTGGCAGGGCCTAGG - Intergenic
959193146 3:103141541-103141563 AATGATGCCAGGCCTGGATTTGG + Intergenic
964785681 3:160393495-160393517 AATGATGGCTGCCAGGGGCTAGG + Intronic
964955601 3:162352099-162352121 ACTGATGTCTGGACTGGCCAGGG + Intergenic
966008109 3:175042088-175042110 AATGATGGTTGCCCTGGGTTAGG - Intronic
967051546 3:185789358-185789380 AATGGTCACTGGCCTAGCCTAGG - Intronic
968045612 3:195622505-195622527 GTTGAGGCCTGGCCTGGCCTGGG + Intergenic
968045639 3:195622583-195622605 GTTGAGGCCTGGCCTGGCCTGGG + Intergenic
968045653 3:195622622-195622644 GTTGAGGCCTGGCCTGGCCTGGG + Intergenic
968045668 3:195622661-195622683 GTTGAGGCCTGGCCTGGCCTGGG + Intergenic
968064365 3:195750387-195750409 GTTGAGGCCTGGCCTGGCCTGGG + Intronic
968064380 3:195750426-195750448 GTTGAGGCCTGGCCTGGCCTGGG + Intronic
968308988 3:197667426-197667448 GTTGAGGCCTGGCCTGGCCTGGG - Intergenic
968309002 3:197667465-197667487 GTTGAGGCCTGGCCTGGCCTGGG - Intergenic
969531829 4:7734622-7734644 CATGATGGCTGGGATGTCCTGGG - Intronic
969911146 4:10447564-10447586 GATCACGGATGGCCTGGCCTGGG + Intronic
969999389 4:11349446-11349468 AAAGTCCGCTGGCCTGGCCTAGG - Intergenic
971077368 4:23165291-23165313 CATGTTGGCTGGGCTGGTCTTGG + Intergenic
972171805 4:36354999-36355021 AATGATGGCTTGGCTTGGCTTGG + Intergenic
973642606 4:52918045-52918067 AGTGCTAGCTGGCCTGGCCCTGG - Intronic
974082957 4:57231466-57231488 AATTATGGGAGGCCTGGGCTGGG + Intergenic
976596134 4:86896951-86896973 AATGATGGCTAGCATGGAGTAGG - Intronic
979602698 4:122603807-122603829 AGTGATGGCTGCCCTGGGGTAGG + Intergenic
982066293 4:151657521-151657543 GAGGATGGCTGGCCAGGCCTGGG + Intronic
982068522 4:151675060-151675082 AATGTTGGCTGGATTTGCCTGGG + Intronic
982078863 4:151767053-151767075 GATGATGGCTGGCCTAGGGTAGG - Intergenic
983186794 4:164709637-164709659 AATGTTGGCTAGGCTGGTCTCGG + Intergenic
983533847 4:168836849-168836871 TATGATTTCTGGGCTGGCCTGGG - Intronic
985680363 5:1252832-1252854 GATGATGGAGGGCCTGGCCAGGG - Intergenic
986261988 5:6155572-6155594 CAGCCTGGCTGGCCTGGCCTTGG + Intergenic
986301276 5:6480155-6480177 TCTGAGAGCTGGCCTGGCCTTGG + Intronic
988993311 5:36692099-36692121 ACTGATGACTGGCCTGCCCTGGG + Intergenic
995537219 5:113149147-113149169 AATGATGGCTGGCTTTGGGTGGG + Intronic
996651313 5:125880124-125880146 ACTTATGGTTGGCCTGGCATGGG + Intergenic
997090296 5:130848826-130848848 AATGGTGGCTGGAAGGGCCTTGG - Intergenic
997383310 5:133453101-133453123 ACTGAGGGGTGGCCTGGGCTTGG - Intronic
998228851 5:140346553-140346575 GCTGCTGGCTGGCCTGACCTAGG - Exonic
999438376 5:151581950-151581972 ACAGATGGCTGGGCTGGGCTGGG - Intergenic
999790012 5:154930666-154930688 AATGATGGTTGCCAGGGCCTGGG + Intronic
1000095632 5:157968741-157968763 TATGATGGCTAGCTTGGGCTCGG - Intergenic
1000302033 5:159965248-159965270 AATCATGGCTCGCCAGGCCTGGG - Intronic
1001757730 5:174183837-174183859 GATGCTTGCTGGCCTGGCTTGGG + Intronic
1002075537 5:176706161-176706183 ATTGATGGCTGTCCTTGCCCAGG + Intergenic
1002772968 6:304863-304885 AATGGTGGCTGCCCGGGGCTGGG - Intronic
1003187372 6:3843950-3843972 GCTGATGGTGGGCCTGGCCTGGG - Intergenic
1003277012 6:4661655-4661677 ACTGAGGGCTTCCCTGGCCTAGG - Intergenic
1003984245 6:11419519-11419541 TATGAGGGCTGGCCTGGCTCTGG - Intergenic
1007752221 6:44077359-44077381 CATGATGGCTGGCCTGGTGTGGG - Intergenic
1011659574 6:89582647-89582669 AATGGTGGCTGGCAGGGGCTGGG - Intronic
1013000307 6:106015216-106015238 AAGGATGGCTGACTTGCCCTGGG - Intergenic
1014277897 6:119407354-119407376 ATTGATGGCTGACCTTTCCTAGG + Intergenic
1014724227 6:124955908-124955930 AAGCATGGCAGGCCTGTCCTTGG - Intergenic
1015938588 6:138426652-138426674 CATGCTGGCTGCCCTGGGCTTGG + Intronic
1017635819 6:156441968-156441990 TATGATGGCTGGCCTGGAACTGG + Intergenic
1019030630 6:169007833-169007855 AAGGATGGCTGGACCGGCATGGG + Intergenic
1019489975 7:1307784-1307806 CATAAGGGCTGGCCTGGCTTCGG - Intergenic
1019530704 7:1501864-1501886 ATGGAGGCCTGGCCTGGCCTGGG - Intronic
1019565028 7:1674860-1674882 GGTGATGGCTGGGCTGGCCCGGG - Intergenic
1019918761 7:4149820-4149842 GAGGAGGGCTGGGCTGGCCTCGG + Intronic
1021794941 7:24245156-24245178 GCTGATGGCTGGCCTTGTCTGGG + Intergenic
1022801850 7:33784188-33784210 AATTTTGGCTTGCTTGGCCTGGG + Intergenic
1023566986 7:41533131-41533153 GATGGTGGCTGGCCTGGAGTTGG + Intergenic
1026548423 7:71345592-71345614 AATGATGTCTGGGCTGACCATGG + Intronic
1026928573 7:74210377-74210399 AACAGTGGCTGCCCTGGCCTGGG + Intronic
1027138419 7:75639980-75640002 AATGATGTCTGCCCTGAGCTGGG + Intronic
1027546949 7:79539312-79539334 AATGTTGGCTGCCCAGGCCTGGG + Intergenic
1028528216 7:91808931-91808953 AATGATGCCTGGGCTGACTTTGG - Intronic
1029673443 7:102049775-102049797 AATGACCGCAGGCCTGCCCTGGG + Intronic
1030073125 7:105714462-105714484 TATTATTGTTGGCCTGGCCTGGG - Intronic
1032838287 7:135693800-135693822 AATGAGAGGTGGCCTGGCTTTGG + Intronic
1034900172 7:154903409-154903431 AGGGAGGGCTGGCTTGGCCTGGG + Intergenic
1035056823 7:156041422-156041444 AATTATCTGTGGCCTGGCCTCGG + Intergenic
1035682387 8:1497456-1497478 AAAGATGGGCCGCCTGGCCTAGG - Intergenic
1036822130 8:11949837-11949859 AATGATGGCTGTTCTGGGGTGGG + Intergenic
1037379167 8:18265941-18265963 AGTGATGGCTGGGATGGGCTGGG - Intergenic
1037548647 8:19948522-19948544 AATGAAGGCTGGCACTGCCTAGG - Intronic
1037892168 8:22629175-22629197 AATTATCACTGGCCTGGCCCAGG - Intronic
1038547194 8:28434851-28434873 TAACATGCCTGGCCTGGCCTCGG - Intronic
1038630162 8:29234483-29234505 AATGGTGGTTGCCCAGGCCTAGG + Intronic
1041627312 8:60045212-60045234 GTTGCTGGATGGCCTGGCCTGGG - Intergenic
1048320923 8:133399711-133399733 AATGGTGGCTGGGCCTGCCTTGG + Intergenic
1048533876 8:135274475-135274497 AATGCTGGATGCCCTGGGCTAGG - Intergenic
1048916925 8:139193934-139193956 AATGATTGCTGGCCTGGAGTAGG - Intergenic
1049625120 8:143616422-143616444 CCAGGTGGCTGGCCTGGCCTGGG - Intronic
1049788240 8:144461558-144461580 TAGGAAGCCTGGCCTGGCCTGGG + Intronic
1051387112 9:16521132-16521154 AAGAATGGCTAGCCTGCCCTGGG + Intronic
1056971474 9:91208532-91208554 AAGGAAGCCTGGCCTGCCCTTGG + Intergenic
1057276742 9:93680237-93680259 GATGACGGCTGGACTGGCCCAGG + Intergenic
1058828855 9:108797645-108797667 AAGGATGGCTGGCCTGCCTCTGG + Intergenic
1059269553 9:113063273-113063295 AAAGGTGGTTGGCCGGGCCTGGG + Intergenic
1059270685 9:113068720-113068742 AAAGGTGGTTGGCCGGGCCTGGG + Intergenic
1059271820 9:113074167-113074189 AAAGGTGGTTGGCCGGGCCTGGG + Intergenic
1059272954 9:113079614-113079636 AAAGGTGGTTGGCCGGGCCTGGG + Intergenic
1059274089 9:113085056-113085078 AAAGGTGGTTGGCCGGGCCTGGG + Intergenic
1061515685 9:131088744-131088766 AATGATGGCTGCCAGGGGCTGGG - Intronic
1062088786 9:134663207-134663229 GAGGATGCCTGGCCTGACCTGGG + Intronic
1062255244 9:135617743-135617765 AATCAGAGCTGGCCGGGCCTGGG + Intergenic
1062306774 9:135911804-135911826 AAGGAGGGCTGGGCTGGGCTGGG + Intergenic
1062421433 9:136484320-136484342 GATGCTGCCTGGCCTGGCCGTGG - Exonic
1188058694 X:25573634-25573656 TATGGTGGCTGGCCTGGCACTGG + Intergenic
1188943595 X:36268143-36268165 TCTGATTGCTAGCCTGGCCTTGG + Intronic
1189991799 X:46602797-46602819 AATGATGCCTGACATGGCATAGG + Intronic
1190374733 X:49777671-49777693 AATTATGCCTGGCCTGTCATAGG + Intergenic
1191690863 X:63936435-63936457 AATGATGGGTGGAGTGGACTAGG - Intergenic
1193173001 X:78358262-78358284 AATGCTTCCTGGCCTGGCCTGGG + Intergenic
1196703539 X:118697138-118697160 AATGATGCCTGGACTGGGCATGG + Intergenic
1197706351 X:129637208-129637230 AATGGGGCCTGGCCTGGCCTTGG + Intergenic
1197966197 X:132064584-132064606 AATGACCACTGGGCTGGCCTGGG + Intergenic
1198530987 X:137549532-137549554 ATGAATGGTTGGCCTGGCCTGGG + Intergenic
1199029405 X:142979294-142979316 AATGATGGTTGTCTGGGCCTGGG + Intergenic
1199060497 X:143350596-143350618 AATGAGGGCTCCCATGGCCTTGG + Intergenic
1199686116 X:150267185-150267207 AATGATGGGTGCCATGGGCTGGG - Intergenic