ID: 1165141146

View in Genome Browser
Species Human (GRCh38)
Location 19:33700694-33700716
Sequence GTGCATAATGATGGCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165141146_1165141159 8 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141159 19:33700725-33700747 GTGGGGAGGGGCAGAGAGGGTGG 0: 1
1: 3
2: 42
3: 496
4: 3560
1165141146_1165141158 5 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141158 19:33700722-33700744 GAGGTGGGGAGGGGCAGAGAGGG 0: 1
1: 2
2: 40
3: 493
4: 3609
1165141146_1165141154 -6 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141154 19:33700711-33700733 ATGCACAATTGGAGGTGGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 270
1165141146_1165141161 21 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141161 19:33700738-33700760 GAGAGGGTGGCCAGAGCCCAGGG 0: 1
1: 0
2: 7
3: 71
4: 833
1165141146_1165141157 4 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141157 19:33700721-33700743 GGAGGTGGGGAGGGGCAGAGAGG 0: 1
1: 2
2: 59
3: 529
4: 3495
1165141146_1165141162 22 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141162 19:33700739-33700761 AGAGGGTGGCCAGAGCCCAGGGG 0: 1
1: 0
2: 4
3: 87
4: 781
1165141146_1165141153 -9 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141153 19:33700708-33700730 ATTATGCACAATTGGAGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1165141146_1165141156 -4 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141156 19:33700713-33700735 GCACAATTGGAGGTGGGGAGGGG 0: 1
1: 0
2: 1
3: 51
4: 553
1165141146_1165141155 -5 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141155 19:33700712-33700734 TGCACAATTGGAGGTGGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 354
1165141146_1165141152 -10 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141146_1165141160 20 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141160 19:33700737-33700759 AGAGAGGGTGGCCAGAGCCCAGG 0: 1
1: 0
2: 8
3: 126
4: 1282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165141146 Original CRISPR GTGCATAATGATGGCTGGCC TGG (reversed) Intronic
901381156 1:8875440-8875462 GTGAACAATGAGGGCTGGCATGG + Intronic
903862301 1:26372112-26372134 GTGCAGATTGATGGCTGGTTGGG - Intronic
908831148 1:68179808-68179830 GTGTAGAATGATGACTGCCCAGG + Intronic
912452584 1:109776480-109776502 GTGCATAATCAGTGCTGGGCGGG - Intergenic
916108038 1:161444809-161444831 GTGCACAGGGCTGGCTGGCCAGG - Intergenic
916109624 1:161452189-161452211 GTGCACAGGGCTGGCTGGCCAGG - Intergenic
916111209 1:161459598-161459620 GTGCACAGGGCTGGCTGGCCAGG - Intergenic
916112797 1:161466980-161467002 GTGCACAGGGCTGGCTGGCCAGG - Intergenic
917387771 1:174495809-174495831 GTGCAAAATGATGTGTGGCTAGG - Intronic
921053334 1:211526599-211526621 TTGCATCATGGTGGCTGGCTGGG - Intergenic
923878977 1:238083343-238083365 GTGGTTAATGCTGCCTGGCCTGG + Intergenic
1066445622 10:35480181-35480203 GTCCCTAATGATGACAGGCCAGG - Intronic
1066712185 10:38247933-38247955 GTGCATCATGATGTTTGCCCTGG + Intergenic
1067410027 10:46055989-46056011 GAGCTTACTGATGACTGGCCAGG + Intergenic
1070076791 10:73144327-73144349 GAGCAGAATAATGGCTGGCTGGG + Intronic
1072044259 10:91638976-91638998 CTGCAAAAGGATGGCTGGCCTGG + Intergenic
1072094527 10:92164162-92164184 GTGTATAATGATAGCTGCCTTGG - Intronic
1074593176 10:114833975-114833997 GTGAATAATGATGTCAGGACTGG - Intronic
1075399450 10:122150550-122150572 GTGCAGAAAGAGGGGTGGCCAGG + Intronic
1075994786 10:126868560-126868582 ATGCAGAATGATGGCTGCCAGGG + Intergenic
1076484383 10:130806569-130806591 GTGCACCATGATGGCTGCCACGG + Intergenic
1078708915 11:13771285-13771307 GTGCAAAATGCTGACTGGCTGGG - Intergenic
1080300072 11:30774332-30774354 GTGGATAAAGATGGCTGGTAGGG + Intergenic
1080442869 11:32311482-32311504 GTGAATAATGCTGACTGCCCAGG + Intergenic
1084636523 11:70396782-70396804 GTGCACAAGGATTGTTGGCCAGG - Intergenic
1086463057 11:87024796-87024818 TGGCAGAATGATTGCTGGCCAGG + Intergenic
1092163400 12:6328352-6328374 GTGCATAAAAATGACTGCCCTGG + Exonic
1093126128 12:15330634-15330656 CTGCCTAATGGGGGCTGGCCAGG - Intronic
1093292867 12:17350250-17350272 CTGTATAATGATGGCTGGCATGG - Intergenic
1096403430 12:51325537-51325559 ATGCTTAATGAAGTCTGGCCGGG + Intergenic
1098010204 12:66043078-66043100 GTGCATAGTGAGTGCTGCCCTGG + Intergenic
1098705627 12:73685273-73685295 GTGGAGAATGTTGTCTGGCCTGG - Intergenic
1102131266 12:110530653-110530675 ATGCTTAATGATGGCTGAGCTGG + Intronic
1105280747 13:18961217-18961239 GTCCATAGTCATGGCTGGCCAGG - Intergenic
1107246135 13:38296935-38296957 GAGCAGAATGATGGCTGCCAGGG + Intergenic
1109275924 13:60304397-60304419 ATGCAGACTGATGGCTGCCCAGG - Intergenic
1110241161 13:73268641-73268663 GAGCCTCCTGATGGCTGGCCAGG - Intergenic
1112098031 13:96156890-96156912 GGGAATAATGGTGCCTGGCCAGG + Intronic
1112526155 13:100149555-100149577 GTGGATACTGAAGACTGGCCGGG + Intronic
1114285086 14:21233959-21233981 TGGCAGAATGATTGCTGGCCAGG - Exonic
1116327722 14:43553243-43553265 GAGCAGAATGATGGCTGCCAAGG + Intergenic
1117552620 14:56851232-56851254 GTGAATGATGATGGGTGGGCAGG + Intergenic
1119775025 14:77242989-77243011 GTTCATGATGATGGCAGGCGTGG - Exonic
1131716245 15:95113836-95113858 GTGGAGAATGCTGACTGGCCAGG - Intergenic
1140702147 16:77591075-77591097 TTGCAAAATAATGGCCGGCCTGG + Intergenic
1142706002 17:1694849-1694871 CGACATAATAATGGCTGGCCGGG - Intergenic
1143648483 17:8248021-8248043 GCGCATCATGGCGGCTGGCCGGG - Exonic
1145761998 17:27430419-27430441 GGGCATGCTGCTGGCTGGCCGGG - Intergenic
1147129151 17:38396037-38396059 ATGCATGATGATGACTGCCCAGG - Intronic
1147432427 17:40380633-40380655 GTGAAGAAAGAAGGCTGGCCAGG - Intergenic
1149324348 17:55514699-55514721 GTTCATTTTGATGGCTGGCCTGG + Intergenic
1155283717 18:24267602-24267624 GTACACAAAGATGGCTGGCTTGG + Intronic
1164100018 19:22046430-22046452 ATGCATAAGAATTGCTGGCCAGG + Intergenic
1165141146 19:33700694-33700716 GTGCATAATGATGGCTGGCCTGG - Intronic
1168584289 19:57580359-57580381 GGGAATAATGAATGCTGGCCAGG + Intronic
925817213 2:7765434-7765456 TTTCATAATGATGACTGGCCTGG - Intergenic
925867279 2:8239801-8239823 TTGCATAATCAAGGATGGCCTGG - Intergenic
926406344 2:12556964-12556986 ATGCAGAATGGTGGATGGCCTGG - Intergenic
926438501 2:12861943-12861965 GTGCTTAATTAAGGCAGGCCCGG + Intergenic
928802946 2:35115969-35115991 GTGTTGAATGATGCCTGGCCTGG - Intergenic
930781269 2:55226309-55226331 TTGCTTAATAATGGCTGGCAAGG + Intronic
932608868 2:73183783-73183805 GTGCACCATCATGCCTGGCCAGG - Intergenic
936138439 2:109917649-109917671 GTGCATAAAGATTCTTGGCCGGG + Intergenic
936206257 2:110453836-110453858 GTGCATAAAGATTCTTGGCCGGG - Intronic
936468105 2:112772047-112772069 GACCATAAGGATAGCTGGCCTGG + Intergenic
943202481 2:184846609-184846631 GTGCATAATCAGGGCTGTCGGGG - Intronic
943601239 2:189923548-189923570 TGGCAGAATGATTGCTGGCCAGG + Intronic
1170321820 20:15108493-15108515 ATACCTAATGATAGCTGGCCTGG + Intronic
1170411607 20:16097987-16098009 GTGCATAATGAGGGCTTAGCAGG - Intergenic
1172697758 20:36834199-36834221 GTCCAGAATGCTGCCTGGCCAGG - Intronic
1175240592 20:57545357-57545379 GTGCATAATAGTGGGTTGCCAGG + Intergenic
1180938181 22:19639636-19639658 CTGAATAAGGCTGGCTGGCCAGG - Intergenic
954698107 3:52438101-52438123 GTGCAGAGTGCTGCCTGGCCCGG - Exonic
954706926 3:52485857-52485879 GTGCATAAGGCTGTGTGGCCAGG - Intronic
956276067 3:67502435-67502457 GTGCTTAAGGATAGCTGGCTAGG - Intronic
958840008 3:99192044-99192066 GTGGTTAATGCTGCCTGGCCTGG - Intergenic
959509507 3:107194947-107194969 GTGCATATTGATGGTTGGGAGGG - Intergenic
961318444 3:126056375-126056397 GTGCATGATGACAGCCGGCCTGG - Intronic
966594811 3:181716128-181716150 ATGCATTACAATGGCTGGCCAGG - Intergenic
969647658 4:8441810-8441832 GTGCATAAAGATTGGGGGCCAGG + Intronic
970171486 4:13295331-13295353 GTGCATGAGGGTGGATGGCCTGG + Intergenic
970413385 4:15833082-15833104 GTGGTTAATGCTGCCTGGCCTGG + Intronic
971250598 4:24970494-24970516 GTGCACCATGATGCCTGGGCTGG - Intronic
982436244 4:155385061-155385083 GGGCATGCTGCTGGCTGGCCGGG - Intergenic
987488677 5:18551082-18551104 GTTCATAATGGTGGCATGCCTGG + Intergenic
989170376 5:38466948-38466970 GAGCATGTTGAAGGCTGGCCAGG + Intergenic
990793903 5:59518445-59518467 GTGCACTATGGTGGCTGCCCAGG + Intronic
993092307 5:83441427-83441449 GTTTATAATGCTGGCTGGCTGGG - Intergenic
996224477 5:120974420-120974442 GTGGATGATGATGGTTGGCATGG - Intergenic
997063974 5:130541570-130541592 ATGCAAAGTGATTGCTGGCCAGG + Intergenic
998059167 5:139105618-139105640 GTGCATAATGCATGCAGGCCCGG + Intronic
1001415806 5:171544267-171544289 GTGCATTTTGAAGGCTGGTCGGG - Intergenic
1002480953 5:179500459-179500481 TTGCCTAATGTTGGCAGGCCCGG - Intergenic
1016185698 6:141195819-141195841 GTGGAGAATGCTGCCTGGCCTGG + Intergenic
1019196949 6:170288627-170288649 GTGCAGAATGAAAGCTGTCCGGG + Intronic
1019887358 7:3917261-3917283 GTGCATAATGAATGCTGACTTGG - Intronic
1021598826 7:22343995-22344017 GTGCATAAACATGGGTGGCTAGG - Intronic
1025770519 7:64501036-64501058 GGGCAGAATAATTGCTGGCCAGG + Intergenic
1031067002 7:117115862-117115884 GTGGATGATAAGGGCTGGCCTGG - Intronic
1043574304 8:81639923-81639945 GAGCAGAATGATGGCTGGGAAGG + Intergenic
1048454665 8:134566935-134566957 GGGCCTAATGATAGCTGCCCTGG - Intronic
1049497622 8:142943750-142943772 CTGCATTGTGATTGCTGGCCCGG - Intergenic
1051991052 9:23153329-23153351 GTCCTTAATGCTGGCTGGCCTGG + Intergenic
1052585744 9:30425414-30425436 GTGCTTAATGCTGCCAGGCCTGG - Intergenic
1057397946 9:94696741-94696763 GTGAATGCTGGTGGCTGGCCAGG + Intergenic
1186248192 X:7637187-7637209 GGACATAATGATGGCAGGCCTGG + Intergenic
1189854384 X:45209269-45209291 GTGCTGAATGCTGCCTGGCCTGG + Intergenic
1189977476 X:46477236-46477258 TTGCAGCATGATTGCTGGCCTGG - Intronic
1193283657 X:79686123-79686145 GTGGATAATGCTGCCAGGCCTGG + Intergenic
1195122912 X:101774924-101774946 GTGGAGAATGCTGCCTGGCCTGG + Intergenic
1196609544 X:117695661-117695683 GTGCTTAATGCTGGCAGGACTGG - Intergenic
1197449514 X:126594407-126594429 GTGCTGAATGCTGCCTGGCCTGG + Intergenic
1199179844 X:144840987-144841009 TGGCAGAATGATTGCTGGCCAGG + Intergenic
1199216251 X:145263146-145263168 GTGCTGAATGCTGCCTGGCCTGG - Intergenic
1200245948 X:154525571-154525593 GGGCATGATGGTCGCTGGCCAGG - Intergenic