ID: 1165141152

View in Genome Browser
Species Human (GRCh38)
Location 19:33700707-33700729
Sequence CATTATGCACAATTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165141145_1165141152 -4 Left 1165141145 19:33700688-33700710 CCTAGGCCAGGCCAGCCATCATT 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141146_1165141152 -10 Left 1165141146 19:33700694-33700716 CCAGGCCAGCCATCATTATGCAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141144_1165141152 -1 Left 1165141144 19:33700685-33700707 CCTCCTAGGCCAGGCCAGCCATC 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1165141141_1165141152 21 Left 1165141141 19:33700663-33700685 CCAGAATGTCTTCGTGGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165141152 Original CRISPR CATTATGCACAATTGGAGGT GGG Intronic
908699617 1:66884387-66884409 CATTATGGAAAACTGTAGGTAGG - Intronic
919551706 1:198998001-198998023 CATTTTGCACTACTGAAGGTTGG + Intergenic
919596880 1:199575333-199575355 CATCAACCACAATTGTAGGTTGG - Intergenic
1070335405 10:75450514-75450536 TATTAAACACAATTGGAGGGAGG + Intronic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1078987413 11:16609220-16609242 CAGTATGCACAAGGTGAGGTTGG + Intronic
1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG + Intergenic
1090469135 11:126963917-126963939 CGTTATGGACAAGTGCAGGTGGG - Intronic
1093143060 12:15532692-15532714 GATTATGCAAAGTTGGAAGTTGG - Intronic
1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG + Intronic
1104802411 12:131563357-131563379 TATTATGTATAATGGGAGGTAGG - Intergenic
1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG + Intergenic
1112114386 13:96336404-96336426 CATTCTGCACCACTGGGGGTTGG - Intronic
1113211335 13:107985337-107985359 CACTGTGGACAATTGGAGGGTGG - Intergenic
1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG + Intronic
1114668271 14:24394264-24394286 CATTATTCACTATGGCAGGTTGG - Intergenic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1120105139 14:80485478-80485500 AGTTATACACAATTTGAGGTTGG - Intronic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG + Exonic
1126643836 15:50855108-50855130 CTTTATGCAAAATTGAATGTAGG - Intergenic
1126745776 15:51825001-51825023 CATTATGGAAGCTTGGAGGTAGG - Intergenic
1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG + Intronic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127756289 15:62095725-62095747 CATTATGCAGAATTAGGGATTGG - Intergenic
1129141068 15:73598400-73598422 AATTATGGGCAATTAGAGGTAGG - Intronic
1130091640 15:80825995-80826017 CAATTTGTACAATTGTAGGTGGG - Intronic
1135201797 16:20443959-20443981 CACATTGCACAATAGGAGGTTGG - Intergenic
1135217307 16:20583907-20583929 CACATTGCACAATAGGAGGTTGG + Intergenic
1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG + Intergenic
1144035675 17:11363354-11363376 CATTAACCAGACTTGGAGGTAGG + Intronic
1145158453 17:20558171-20558193 CTTTATTCACAATAGGAGGGGGG - Intergenic
1149115223 17:53085988-53086010 CATTACTCACAAGTGTAGGTTGG - Intergenic
1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG + Intergenic
1155864678 18:30950623-30950645 CATGACACACAGTTGGAGGTAGG - Intergenic
1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG + Intronic
1157982829 18:52401770-52401792 CATTATGCTCAATTTTAGGAAGG + Intronic
1160112554 18:76047514-76047536 GATTATGCACTATTGGCGGCAGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG + Intronic
929022084 2:37563455-37563477 CATTCTGCACACTTGTAGGGCGG + Intergenic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
939396033 2:141630806-141630828 CAATATGCACAATTGATAGTTGG - Intronic
947228617 2:227863453-227863475 AATTAGTCACAGTTGGAGGTAGG + Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG + Intronic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
958447272 3:94231286-94231308 CATTAAGCATAATTTGAGTTAGG - Intergenic
958691055 3:97466782-97466804 CAATATGCACAAGAGGAAGTTGG - Intronic
965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG + Intergenic
974697047 4:65389733-65389755 CATTGAGAACTATTGGAGGTAGG + Intronic
979857678 4:125653800-125653822 CATTGTACATAATTGGATGTGGG + Intergenic
980639328 4:135555039-135555061 CATTATACAGAATTGGAGGAAGG - Intergenic
980864357 4:138536926-138536948 CATTATGGACAATGGTATGTAGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981856136 4:149295195-149295217 CATTCTGAAGTATTGGAGGTTGG - Intergenic
987619519 5:20322260-20322282 CATTATGAACAATTGGTGTTTGG - Intronic
988345471 5:30032337-30032359 CATTATAGACAATTCCAGGTAGG - Intergenic
991122760 5:63034488-63034510 CATTATGAGCAACTTGAGGTAGG - Intergenic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
994596214 5:101839705-101839727 CATTATATATAATTGGAGATAGG - Intergenic
994865035 5:105257569-105257591 CATTTTGCACCAGTGTAGGTAGG - Intergenic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG + Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1004978738 6:20998288-20998310 CATACTGCACACTTGGAGCTGGG - Intronic
1011061952 6:83279997-83280019 CATGATGCAGAATTGTAGGTTGG - Intronic
1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG + Intronic
1018977804 6:168578772-168578794 TATTATGAAGAATTGGACGTGGG + Intronic
1020852474 7:13374222-13374244 CATTATGCATTATTGAAAGTGGG + Intergenic
1025069456 7:55886386-55886408 CATTTTGCTTAATTGGAGTTCGG - Intergenic
1030935586 7:115581876-115581898 CATTGTGCACTGTTGGGGGTGGG - Intergenic
1031112713 7:117631132-117631154 CAAAATCCAAAATTGGAGGTTGG - Intronic
1033041289 7:137920833-137920855 CATTCTGAACTACTGGAGGTTGG + Intronic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1041894234 8:62905387-62905409 CTTTATTCACAATTTGAGGTAGG - Intronic
1045468833 8:102493075-102493097 AATTATGGATAATTGGAGGAGGG - Intergenic
1047886707 8:129259166-129259188 CAATATACACAATGGGAGGAGGG + Intergenic
1048534227 8:135277484-135277506 CATTATGCACCATCGGAGAAGGG + Intergenic
1051311661 9:15780655-15780677 CTTTATGCACAGTTGTAGTTTGG + Intronic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1202279784 Y:23170306-23170328 CATCATGAACAATGGGATGTGGG - Intronic
1202280513 Y:23181146-23181168 CATCATGAACAATGGGATGTGGG - Intronic
1202281242 Y:23191994-23192016 CATCATGAACAATGGGATGTGGG - Intronic
1202284649 Y:23226526-23226548 CATCATGAACAATGGGATGTGGG + Intronic
1202432914 Y:24806377-24806399 CATCATGAACAATGGGATGTGGG - Intronic
1202436323 Y:24840913-24840935 CATCATGAACAATGGGATGTGGG + Intronic
1202437051 Y:24851761-24851783 CATCATGAACAATGGGATGTGGG + Intronic