ID: 1165142970

View in Genome Browser
Species Human (GRCh38)
Location 19:33713447-33713469
Sequence CTGTAGGAAAAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165142970_1165142978 -4 Left 1165142970 19:33713447-33713469 CCCACTTCCCTCTTTTCCTACAG 0: 1
1: 0
2: 1
3: 59
4: 487
Right 1165142978 19:33713466-33713488 ACAGGGTCTCCATTTCTCCTGGG 0: 1
1: 0
2: 2
3: 28
4: 409
1165142970_1165142977 -5 Left 1165142970 19:33713447-33713469 CCCACTTCCCTCTTTTCCTACAG 0: 1
1: 0
2: 1
3: 59
4: 487
Right 1165142977 19:33713465-33713487 TACAGGGTCTCCATTTCTCCTGG 0: 1
1: 1
2: 1
3: 22
4: 197
1165142970_1165142981 13 Left 1165142970 19:33713447-33713469 CCCACTTCCCTCTTTTCCTACAG 0: 1
1: 0
2: 1
3: 59
4: 487
Right 1165142981 19:33713483-33713505 CCTGGGAGCATATAGCTCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165142970 Original CRISPR CTGTAGGAAAAGAGGGAAGT GGG (reversed) Intronic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
904364110 1:29999653-29999675 GGGTAGGAAAAGAAGGGAGTGGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904735175 1:32626486-32626508 CTGTACAAAAAGAGGCAATTTGG - Intronic
905187910 1:36209953-36209975 GTGGAGGTAGAGAGGGAAGTGGG + Intergenic
906353544 1:45083867-45083889 CAGGAGGAAGAGAGAGAAGTGGG + Intronic
906625226 1:47319603-47319625 CTGAAGGAAAAAAAGAAAGTTGG - Intergenic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
908042676 1:60131727-60131749 CTGTAGGAAAATAAGTTAGTGGG + Intergenic
908114751 1:60929668-60929690 CTATAGGAGAATAGGGAAGGGGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909382046 1:75009878-75009900 CAGGAGGAAGAGAGAGAAGTAGG - Intergenic
910734867 1:90442629-90442651 GTGTAAGAAAACAGGGAAGATGG + Intergenic
910744633 1:90560230-90560252 TTGTAGGGAAAGTGGGATGTTGG + Intergenic
910820805 1:91343539-91343561 TTTTAGTAAAATAGGGAAGTAGG + Intronic
910867124 1:91798851-91798873 CTGTAGGGAATAAGGGAAATAGG + Intronic
911268579 1:95773637-95773659 CTGAAGGAAAATATTGAAGTGGG + Intergenic
911347226 1:96711612-96711634 GTCTAGGCAAAGAGGGAAGCAGG + Intergenic
911614853 1:99998499-99998521 CTCTAAGAAAAGTGGGAAGGTGG - Intronic
912283275 1:108340533-108340555 CTGCATGAAACTAGGGAAGTGGG - Intergenic
912832502 1:112966223-112966245 AGGGAGGAAAAGAGGGAGGTGGG - Intergenic
913181602 1:116327814-116327836 CTCTGGGAAAAGAGTGAATTGGG - Intergenic
913237588 1:116798130-116798152 ATGTGGGAAAAGAGGGCTGTAGG + Intergenic
913615526 1:120556735-120556757 TTATAGGAAAAAAGTGAAGTAGG + Intergenic
913616362 1:120564094-120564116 CTGTAGGTAAAGAGAGATGTTGG + Intergenic
914573915 1:148946810-148946832 CTGTAGGTAAAGAGAGATGTTGG - Intronic
914574749 1:148954171-148954193 TTATAGGAAAAAAGTGAAGTAGG - Intronic
915780028 1:158537812-158537834 GTGTAGGGAGAGAGGGCAGTGGG - Intergenic
916699090 1:167272601-167272623 CAGGAGGAAGAGAGAGAAGTAGG + Intronic
916793719 1:168146258-168146280 TGGGAGGAGAAGAGGGAAGTGGG + Intergenic
917133795 1:171768632-171768654 CAGGAGGAAAAGAGTGAAGCAGG + Intergenic
917165075 1:172102759-172102781 AGGGAGGAAAAGAGGGAAGCAGG - Intronic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
917696127 1:177525927-177525949 CTTTAGGAAAATGGGAAAGTAGG + Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
919058690 1:192603480-192603502 CTGTTGGAAGAAAGGAAAGTGGG - Intergenic
919197367 1:194304232-194304254 GTGTAGAAAAAGTGGGTAGTAGG + Intergenic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922656324 1:227387391-227387413 CGGGAGGAAGAGAGGGAAGGAGG + Intergenic
922779892 1:228243527-228243549 TTGTAAGAAAAGAGGCAATTAGG - Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924209204 1:241747393-241747415 CTGTAAGCAATGGGGGAAGTTGG + Intronic
1063422596 10:5925225-5925247 TTGTAGGAAAAGGGGGAAAGAGG - Intronic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065838047 10:29677165-29677187 CTGAAGGCAAAAAGGGAAGGGGG - Intronic
1065862091 10:29880429-29880451 AAGTAGGAAAAAAGGGAAGGGGG + Intergenic
1065930190 10:30472432-30472454 GAGTAAGGAAAGAGGGAAGTGGG + Intergenic
1065991449 10:31013859-31013881 GTGAAGGAAAAGAGGCAAATAGG - Intronic
1066093500 10:32050077-32050099 CTAAAGGAAAGGAAGGAAGTTGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068881702 10:62056186-62056208 CTGTAGGCAGACAGGGAACTTGG - Intronic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069259096 10:66371679-66371701 CTGTTAGCAAAGGGGGAAGTTGG - Intronic
1069474528 10:68721199-68721221 GTGGAGGAAGAGGGGGAAGTTGG + Exonic
1070299730 10:75194436-75194458 CTGTATGAACAGAGGACAGTGGG - Intergenic
1070780205 10:79133137-79133159 CTGCAGGAAAAGAGTGTACTAGG - Intronic
1071996867 10:91157993-91158015 TTGAAGTAAAAGAGAGAAGTGGG + Intergenic
1073271426 10:102267581-102267603 CTGTAGGAAAAAATAAAAGTAGG - Intronic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1074210919 10:111334243-111334265 ATTTAGAAAAAGAGGGAATTAGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076051935 10:127341994-127342016 ATGTAGGAAAAGAAAGAATTAGG + Intronic
1076083172 10:127601704-127601726 CTGTAGGATGAGAGGAGAGTTGG - Intergenic
1076242595 10:128920908-128920930 CAGAAGGAAAAGAGCGAAGCTGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077146730 11:1049873-1049895 CTGTAGGAAAATGGGGACGTCGG + Intergenic
1077391836 11:2303886-2303908 AGGGAGGAAAAGAGGGAAGGAGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1078224910 11:9383267-9383289 CTCTAAAAAAAGAGGGAGGTGGG - Intergenic
1078422104 11:11220986-11221008 CTCTAGGAAATGAAGGAGGTGGG - Intergenic
1078642825 11:13112201-13112223 CTTTAGAAAAAGAGGGAATTTGG + Intergenic
1079538233 11:21540643-21540665 CTGGAGGAAGAGAGTGAAGGGGG + Intronic
1080255524 11:30286507-30286529 ATGGAGAAAAATAGGGAAGTGGG + Intergenic
1080581994 11:33651778-33651800 CGGGAGGGAATGAGGGAAGTGGG - Intronic
1081443888 11:43110785-43110807 GTGCAGGTCAAGAGGGAAGTGGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1084666966 11:70581724-70581746 CTGAAGGCAAAGACTGAAGTTGG + Intronic
1084989902 11:72913041-72913063 CAGGAGGAAAAGAGAGAAGGGGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1085731988 11:79007796-79007818 CTGAAAGAACAGTGGGAAGTTGG + Intronic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087350651 11:97027676-97027698 ATGCAGGAAAGGAGAGAAGTAGG - Intergenic
1087362320 11:97176603-97176625 CTTTAGAAAAAGAGGAAATTTGG - Intergenic
1087829679 11:102805869-102805891 GGGTAGGATGAGAGGGAAGTGGG - Intergenic
1088217595 11:107529947-107529969 CTGTAGGGAACTAGAGAAGTAGG + Intronic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1090287219 11:125510333-125510355 CTAAGGGAAAAGAGGGAAGGAGG + Intergenic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092829449 12:12429675-12429697 GTGAGGGAAACGAGGGAAGTAGG - Intronic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094319217 12:29167361-29167383 AAGAAGGAAAAGAGGGAGGTTGG - Intronic
1094749760 12:33392393-33392415 TTGAAGGAAAAGGGGAAAGTGGG - Intronic
1095238793 12:39832541-39832563 AAGCAGGAAAAGTGGGAAGTTGG - Intronic
1096068306 12:48758795-48758817 TTGGAGGAAAAGAAGGAGGTAGG - Intergenic
1097070132 12:56348670-56348692 GTGTAGGGAAGGAGGGACGTGGG + Intronic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098692797 12:73510310-73510332 CACTATGAAAAGAGGGAAGGTGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101154543 12:101915313-101915335 CTTTAGTAAAAGAGGGTAGAGGG + Intronic
1101825520 12:108217424-108217446 ATGCAGGAAATGAGGGAAGTGGG + Intronic
1102570498 12:113824390-113824412 CTCCAGGAAAAGAGCGAGGTTGG + Intronic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1104243092 12:127010141-127010163 CTGAAAGAAAGAAGGGAAGTAGG - Intergenic
1105662157 13:22508426-22508448 CTGGAGGAAAAATGGGAAGAAGG - Intergenic
1108103684 13:46985528-46985550 CTGTGGGAAACGTGGGCAGTAGG + Intergenic
1108147061 13:47488949-47488971 TGGTAGGAAAAGAGTGTAGTGGG + Intergenic
1109261859 13:60154470-60154492 CTGTAAGAAAAGATAGCAGTGGG + Intronic
1109565164 13:64103923-64103945 CTGCATGAAAAGTGGGAATTAGG + Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1109645239 13:65245532-65245554 CTGTAGGATATGAAGAAAGTTGG + Intergenic
1110870220 13:80443555-80443577 GTGTATGAAAAGAGAGAAGGAGG - Intergenic
1111726432 13:92015446-92015468 TTGTAGGAGAAGAGGGACCTGGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112354053 13:98659961-98659983 CTGTAGGCAAAGACTGAATTGGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1112810933 13:103217737-103217759 CTTAAGGAAAAGAGTGTAGTAGG + Intergenic
1114653493 14:24301717-24301739 TTGCAGGTAAGGAGGGAAGTAGG + Exonic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1115504131 14:34078217-34078239 CATGAGGAAAAAAGGGAAGTGGG + Intronic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1116410946 14:44622832-44622854 CTGTAGGAAAACCGTAAAGTAGG - Intergenic
1116962388 14:50979550-50979572 CTGTAGGAAAAGAGAAAAATTGG + Intronic
1116974046 14:51095757-51095779 CTTTAGGAAACGAGGGACGCAGG - Exonic
1117243527 14:53860316-53860338 CTGTAGGAAAAGTGGGCATAGGG + Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1119682508 14:76603461-76603483 GTGTAGGAAAAATGGGATGTGGG + Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120597969 14:86464760-86464782 AGGGAGGAAAAGAGGGAAGGGGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121930426 14:97966989-97967011 CTGTAGGGAAAATGGGGAGTAGG - Intronic
1122505938 14:102231805-102231827 CCGTAGGAAAACAGAGAAGCGGG - Exonic
1124037766 15:26071980-26072002 TTGCATGAAAAGAGGAAAGTAGG - Intergenic
1124146977 15:27136939-27136961 CTCTTGGAGAAGAGGCAAGTGGG - Intronic
1125204072 15:37131334-37131356 ATGCAGGAAAAGAGGGAAGAGGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125294302 15:38185595-38185617 ATGGAAGAAAAGAGGGAGGTTGG + Intergenic
1125646849 15:41279816-41279838 ATGTTGGAAGACAGGGAAGTAGG - Exonic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126889591 15:53190070-53190092 AGGGAGGAAAAGAGGGAAGGAGG + Intergenic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128984451 15:72208892-72208914 CTGTATGAAAAAGGGTAAGTAGG + Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130562609 15:84970452-84970474 CAGGAAGAAAAGTGGGAAGTAGG + Intergenic
1131563209 15:93462270-93462292 CTACAGGGAAAGAGGGAAGGAGG - Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131938416 15:97533617-97533639 CTGGAGGAAATGAGACAAGTTGG + Intergenic
1132210510 15:100018535-100018557 CAGGAGGAAGAGAGAGAAGTGGG - Intronic
1133385682 16:5368418-5368440 CTGAAGAAAAACAAGGAAGTGGG - Intergenic
1133882019 16:9791283-9791305 GGTTAGGAAAAGAGGGAAGGAGG + Intronic
1134054412 16:11160509-11160531 CTGAAGGGAAAGAGGGAAAGGGG - Intronic
1137402994 16:48168414-48168436 CTGTGGGAAAAGAGCTCAGTGGG - Intronic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137737559 16:50736208-50736230 GTGTAGGGAACTAGGGAAGTAGG + Intergenic
1137910551 16:52373585-52373607 CTCTGCCAAAAGAGGGAAGTGGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138517181 16:57542624-57542646 CTGCAGGAAGAAGGGGAAGTCGG - Intronic
1139615838 16:68090714-68090736 CAGTATGAAAAGGAGGAAGTTGG + Intronic
1140294301 16:73693558-73693580 ATGAAGGATAAGAGGAAAGTTGG + Intergenic
1141581938 16:85005225-85005247 CTCTAGGAAGACAGGGAAGGAGG - Intronic
1142138705 16:88463085-88463107 TTGATGGAAAAAAGGGAAGTTGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143916117 17:10294704-10294726 CAGGAGGAAAAGAGAGAAGTGGG + Intergenic
1144909523 17:18669804-18669826 ATTTAGGAAAACAGTGAAGTTGG + Intronic
1145024169 17:19455308-19455330 ATGTAGGAAAAGGGGCAGGTAGG - Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1149281581 17:55111127-55111149 CTGTAGGGAAATCTGGAAGTAGG - Intronic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1151229971 17:72677454-72677476 CTTTAGGAAAAAAGAGAAGAGGG + Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151376352 17:73691488-73691510 CTGTAGGAGAAGGGGGAAGCTGG - Intergenic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1153229013 18:2919544-2919566 CTGTAATAAAAGTGGGAAGGTGG - Exonic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155285687 18:24286855-24286877 CTGGAGAAAAAGGGGTAAGTTGG + Intronic
1155472785 18:26208338-26208360 CTGAAGAAAAAGAAGGGAGTGGG + Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155946679 18:31860746-31860768 TTGTAAGAGAATAGGGAAGTTGG - Intronic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1158106866 18:53895372-53895394 GTGTGGGAAAAGAGGCAAGTCGG + Intergenic
1158311701 18:56166426-56166448 CTATAGGAAGAGAGGGAAGGGGG + Intergenic
1158561654 18:58519099-58519121 CTGCAGGAAAACAGGCAAATGGG + Intronic
1158671863 18:59482618-59482640 CTGTAGGAAAAAATGGCAGTTGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159321701 18:66859343-66859365 GTCTAGGGAAAGAGGGAAGTGGG + Intergenic
1159380887 18:67657879-67657901 ATGTAGGAAAAGAAAGAAGTGGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159938161 18:74385036-74385058 TTGTAGGAAAAGTGAGATGTGGG - Intergenic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162722753 19:12672306-12672328 ATGCAGGAAAAGGGGGAATTGGG + Intronic
1163204911 19:15795235-15795257 GAGAAGGGAAAGAGGGAAGTAGG - Intergenic
1163669692 19:18620385-18620407 CTGCAGGAAGAGAGGGGAGGAGG - Intronic
1164215234 19:23138913-23138935 CTGTAGGAAAATAAGCAAATAGG + Intronic
1164535225 19:29081071-29081093 ATGTAGGAAAGTAGGAAAGTGGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164923168 19:32104842-32104864 CTGCCAGAAAAGAGGGGAGTGGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165381028 19:35480480-35480502 CTGTAGAAAAAAAGGGAAAGGGG - Intergenic
1165762432 19:38329560-38329582 ATGCAGGGAAAGAGGGAAGGAGG + Intergenic
1165798833 19:38535331-38535353 CTTAAGGACAAGAAGGAAGTTGG + Exonic
1166144087 19:40822400-40822422 CTGGAGGGGAAGGGGGAAGTGGG + Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166807788 19:45497245-45497267 CTTTAGGGGAAGAGGGAAGGAGG + Intronic
1167347802 19:48957160-48957182 CTGTTGGAACAGAGTGAACTGGG + Intronic
1167606527 19:50483972-50483994 CTCTAGGAAAAGAATGAAGCAGG - Exonic
1168172255 19:54596565-54596587 CACTAAGAAAAGAGGGGAGTTGG + Intronic
925628210 2:5863043-5863065 ATTTAGGAAAACAGGAAAGTTGG + Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926545846 2:14238797-14238819 CAGGAGGAAAAGAGTGAAGCAGG - Intergenic
926599537 2:14826973-14826995 CTATAGAAAATGAGGGTAGTGGG - Intergenic
927040128 2:19221142-19221164 CTGTAAGAAAAGCTGGTAGTAGG + Intergenic
927352795 2:22137554-22137576 CAATAGCAAGAGAGGGAAGTAGG + Intergenic
927395672 2:22648185-22648207 CTGGAGGAAGAGAGAGAAGTGGG - Intergenic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928388370 2:30888920-30888942 CAGTAGGAAAATTGGGAGGTGGG - Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929689818 2:44064897-44064919 CTTGAGGGAAAGAGGGAACTGGG - Intergenic
929767833 2:44864164-44864186 TTGAAGGAAAAGAACGAAGTTGG + Intergenic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
930908058 2:56597687-56597709 GGCTAGGAAGAGAGGGAAGTGGG + Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931881489 2:66575458-66575480 CCACAGGAAAAGAGGAAAGTCGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933747081 2:85579192-85579214 CTGGAGGAAAACAGGGAGGGAGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
935261576 2:101360215-101360237 ATGTAGGAAGAGAGGCAGGTAGG - Intronic
935293726 2:101630498-101630520 CTGGAGGAAAACAGGGAGTTGGG + Intergenic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
935924106 2:108048479-108048501 CTGAAGGGAAAGAGTGAAGGTGG - Intergenic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
937077963 2:119120821-119120843 CTCTGGGAGAAGAGGGAAATTGG + Intergenic
937348225 2:121141466-121141488 TTGTAGGAAAAAAGTGGAGTTGG - Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938636327 2:133230727-133230749 CTGAGGGAAAAGAGGAAAATGGG - Intronic
938826373 2:135009640-135009662 CTGTAGGAAAAGTTGGAAGCCGG + Intronic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940488246 2:154324099-154324121 GTGTGGGAAAAGAGTGGAGTAGG - Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940963881 2:159816293-159816315 CTAGAGGAAAAGTGGGAAGAAGG + Intronic
941058730 2:160820154-160820176 TTGTAGGAAAATAAGAAAGTTGG - Intergenic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941900742 2:170676038-170676060 CTCTAGTAAAAGAAGGGAGTGGG + Intergenic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944412548 2:199458179-199458201 CCGCAAGAAAAGAGGGGAGTGGG + Intronic
945194282 2:207223832-207223854 CTGAAGAAAATGAGTGAAGTGGG - Intergenic
945964224 2:216168959-216168981 GTGTAGGAAAAGAAGGCATTAGG - Intronic
947586481 2:231360043-231360065 CTGTAGGAGAAGAGGAGAGGCGG + Intronic
948013083 2:234665504-234665526 GGGAAGGAAAAGAGGGAAGGAGG - Intergenic
1168837453 20:887206-887228 CTGCAGGAAAAGAGAGAATTGGG + Intronic
1169480444 20:5975295-5975317 ATGTAGGAAAAGATGCAAGTGGG + Intronic
1169642785 20:7773521-7773543 CCGTAGGAATAGAGGAGAGTAGG + Intergenic
1170320003 20:15085183-15085205 CTCAAGGAAAAGAATGAAGTTGG + Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170495679 20:16922486-16922508 CAGTAGGAAAACAGGCAAATGGG - Intergenic
1171042641 20:21779643-21779665 AGATAGGAAAAGAGGGAAGAGGG - Intergenic
1171049891 20:21847469-21847491 CAGATGGAAAAGAGTGAAGTTGG + Intergenic
1171177259 20:23061715-23061737 CTGCAGGAAAGAAGGGCAGTGGG + Intergenic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1173044577 20:39497427-39497449 AGGTAGGAATAGAGTGAAGTAGG - Intergenic
1173417345 20:42868817-42868839 CTGTATGAAAAAAGGGATCTTGG + Intronic
1173754319 20:45501681-45501703 ATGGAGGAAAAGAGGGACCTGGG - Intergenic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1175338235 20:58210319-58210341 AAGTAGGGAAAGAGGGGAGTTGG + Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176034674 20:63030414-63030436 CTGAAGGAAAATCGGGAAGCGGG - Intergenic
1176371397 21:6063971-6063993 CTGTTGTAAAAGATGGACGTAGG - Intergenic
1178084397 21:29098312-29098334 CAGTAGAAAAAAAGAGAAGTGGG - Intronic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178998416 21:37429509-37429531 CAGGAGGAAAAGAGAGAAGTGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179752122 21:43474568-43474590 CTGTTGTAAAAGATGGACGTAGG + Intergenic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1181769533 22:25115300-25115322 CTGGAATAAAAGCGGGAAGTGGG + Intronic
1181977049 22:26737592-26737614 CTGCAGGAAAAGTGGGATGGAGG - Intergenic
1183586171 22:38754540-38754562 TAGTAGGAAAAGCAGGAAGTTGG + Intronic
1184904183 22:47468906-47468928 CTGTAGGAAAAGACAGAAATAGG + Intronic
1185373513 22:50471549-50471571 CTATAGGAAAAGAGAAAAGAAGG + Intronic
949196703 3:1318563-1318585 CCAAAGGAAAAGAGGGAAGTGGG + Intronic
949249363 3:1964200-1964222 CTTTACTAAAAGAGGAAAGTGGG + Intergenic
949807381 3:7970388-7970410 CTGTAGGAAAGGGTGGGAGTGGG + Intergenic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950329213 3:12143031-12143053 CTGTAGGTAGAGAGGGTAATGGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950483634 3:13260099-13260121 CTGGAGGAAGAGGGGGAAGGAGG + Intergenic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951670290 3:25174000-25174022 CTGTAGGAAGACAAGGAATTAGG + Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952656302 3:35790030-35790052 GGGAAGGAAAAGAGGGAAGTGGG - Intronic
953151567 3:40329987-40330009 CTCTAGTGAAAGATGGAAGTAGG + Intergenic
953659985 3:44884867-44884889 CTGAAGGGAAAGAGGGGAGCGGG - Intronic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954851421 3:53604193-53604215 TTGTGTGAAAAGTGGGAAGTGGG + Intronic
955225500 3:57056970-57056992 CTAAAGGAAAAGATGGAAGGGGG - Intronic
955535478 3:59918925-59918947 CTGCAGGAAAAGCAGGAAGTAGG + Intronic
955917576 3:63922364-63922386 CTCTAGTAAAAATGGGAAGTGGG + Intronic
955928524 3:64031950-64031972 TTATAGGAAAGGAGGGAGGTAGG - Intergenic
956606438 3:71077588-71077610 CTGTAGGAAGTCGGGGAAGTGGG - Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956760644 3:72440664-72440686 CTATAGGTAAAAAGGGAAGTGGG + Intronic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957876347 3:86151609-86151631 CTGTTGGAAGAGAAGCAAGTAGG - Intergenic
958008103 3:87839497-87839519 CTGAGTGAAAAGAGCGAAGTAGG - Intergenic
958550980 3:95611634-95611656 GTGTAGGAAAACAAGGAAGATGG - Intergenic
959027586 3:101258099-101258121 TAATAGGAAAAGAAGGAAGTAGG - Intronic
959336397 3:105070581-105070603 ATGGAGGGACAGAGGGAAGTGGG + Intergenic
959465560 3:106682013-106682035 CTGTGGCACAAGAGGGATGTGGG + Intergenic
960626658 3:119687858-119687880 CTGCAGGAAAAGAGAGAATGAGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962784779 3:138757667-138757689 AGGTAGGAAAAGAGGGAGGGAGG + Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
965230414 3:166043841-166043863 ATGGAGGAAAAGAAGGCAGTTGG + Intergenic
965939523 3:174161625-174161647 GTATAGGAAAAGAAGGAATTAGG + Intronic
966007747 3:175037188-175037210 CTGGAGGACAAGTGGGAAGCTGG - Intronic
966547127 3:181161894-181161916 CTGGAGCAAGAGAGAGAAGTGGG + Intergenic
968627518 4:1633872-1633894 CTGCAGGAAAAGAGAAAAGGGGG + Intronic
968824519 4:2884735-2884757 ATTTAGGAGAAGAGGGAAGCAGG + Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969283057 4:6184393-6184415 TTCTAGGAAAGGAGGGAAGGCGG - Intronic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
972169577 4:36328806-36328828 CAGTAGGAAAATAGGGAATAGGG - Intronic
972774414 4:42228107-42228129 CAGGAGGAAAAGAGCGAAGGGGG - Intergenic
973170022 4:47130490-47130512 ATACAGCAAAAGAGGGAAGTGGG - Intronic
973189652 4:47372607-47372629 CAGGAGGAAAAGAGTCAAGTCGG + Intronic
973271483 4:48267538-48267560 CTGTTGGAAAAAAGTGAAATTGG - Intronic
976142154 4:82003599-82003621 CAGGAGGAAGAGAGCGAAGTGGG - Intronic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
977445985 4:97132807-97132829 CTCTAAGAAAACAGGGAAGTTGG - Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
982298129 4:153851021-153851043 CTGTAGGAAAACAGGGGAAGGGG + Intergenic
982424405 4:155241458-155241480 CAGAAGGAAAAGAGAGAATTTGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982571519 4:157056615-157056637 TTATAGGAACAGAGGTAAGTAGG + Intergenic
984237489 4:177178005-177178027 CTGAAGGAATATAAGGAAGTTGG - Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
984785768 4:183566044-183566066 ATGGAGGAAATGAGGGAAGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985924415 5:3004696-3004718 CTGCAGGAAAAGCGGGAAGAGGG + Intergenic
986409932 5:7467317-7467339 GTGTAGGAGAAGAGGGAGCTTGG - Intronic
986547482 5:8914345-8914367 CAGTAGGAAGAGAGCAAAGTGGG + Intergenic
987033837 5:14000183-14000205 CCTTCTGAAAAGAGGGAAGTTGG + Intergenic
987606661 5:20144398-20144420 CTATACCAAAAGAGAGAAGTTGG - Intronic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990221078 5:53589445-53589467 ATGTAGGAAAAGAGGCAGTTAGG + Intronic
990488417 5:56280924-56280946 CTGGAGGAAAAGAAGGGAGCAGG - Intergenic
990491782 5:56309916-56309938 CTGTAGGAAATAAGGAAAATAGG + Intergenic
990987106 5:61650696-61650718 CTGTTGGAAAAGATGCATGTTGG - Intronic
991614946 5:68486389-68486411 CTGTAGTAAAAAGGGGAAGGAGG - Intergenic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
993351830 5:86858977-86858999 CAGGAGGAAAAGAGAGAAGTGGG - Intergenic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994751903 5:103748395-103748417 CTGTAGGAATAAAGGAAAATTGG - Intergenic
994898576 5:105739675-105739697 CAGGAGGAAAAGAGGCAGGTAGG - Intergenic
995091684 5:108185389-108185411 AGGAAGGAAAAGAGTGAAGTGGG - Intronic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
998362312 5:141599673-141599695 ATGTCAGAAAAGAGAGAAGTAGG - Intronic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000016335 5:157280572-157280594 CAGGAGAAAAAAAGGGAAGTTGG + Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000240863 5:159406823-159406845 TTGTGGGAAAAGAGAGAAGCAGG + Intergenic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003009221 6:2410489-2410511 GTGGAGGAAGAGAGGGAAGGGGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004262978 6:14124415-14124437 CTTTAGGAAAAGAAGGATGCTGG + Intronic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005129156 6:22484624-22484646 TTGAAGGAAAAGAAGAAAGTTGG + Intergenic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007994240 6:46289169-46289191 ATGTAGGAGAGGAAGGAAGTTGG - Intronic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008527259 6:52419578-52419600 CTCTACGGAAGGAGGGAAGTAGG + Intergenic
1008621227 6:53273345-53273367 CTGCAGGAACAGAGGGATTTGGG + Intronic
1009449478 6:63784592-63784614 CAGGAGGAAAAGAGTGAAGGGGG + Intronic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1010472217 6:76242183-76242205 CAGGAGGAAAAGAGAGAAGGGGG - Intergenic
1011064286 6:83308817-83308839 ATGTATGAAAAGAGGAAAGTGGG + Intronic
1011762190 6:90579253-90579275 CTTTAAGAAAAGAGTGAAGTTGG + Intronic
1013402497 6:109812499-109812521 ATGTAAGCAAAGAGGGAAATAGG + Intronic
1014436579 6:121427389-121427411 TGGGAGGAAAAGAGGGAGGTGGG + Intergenic
1015050839 6:128837599-128837621 CAGTAGGAAGAAAGTGAAGTGGG - Intergenic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1018879889 6:167867088-167867110 CTGAAGGTAAAGAGGGAACTGGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1020677842 7:11201825-11201847 CCTTAGGAGAAGAGGGGAGTGGG + Intergenic
1021157578 7:17230732-17230754 AATTAGGAAAAGAGGGAAGAGGG + Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1024121521 7:46245952-46245974 CTGTAGGAAATGGGGTAGGTGGG - Intergenic
1025851655 7:65249514-65249536 ATGTATGAAAAGATGGAAATGGG + Intergenic
1027635572 7:80668331-80668353 AACTAGGAAAAGAGGGAATTTGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1032147299 7:129395630-129395652 CTGTAGGAAGAGCAGGAATTGGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1033007122 7:137578403-137578425 CTGTAGGATAGGAGGGAGCTGGG - Intronic
1033247165 7:139727322-139727344 CTGTGGGAAAAGAGGGCTATTGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1036984663 8:13514939-13514961 CTGTACGAAGAGAGGGGAGGAGG + Intronic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1038385937 8:27145244-27145266 CTGTTGTGAAAGAAGGAAGTAGG - Intergenic
1038652509 8:29418451-29418473 CTGAAGGGAAAGAGGCTAGTGGG + Intergenic
1039493855 8:37966489-37966511 CGGTAGGGAAAGAAGGAAGGAGG + Exonic
1039550339 8:38438874-38438896 CTTGAGGAAATGAGGGAAGGAGG - Intronic
1040770773 8:50972543-50972565 ATTTAGGAAAAGAGGAAAGCTGG + Intergenic
1041097114 8:54361355-54361377 AGGAAGGAAAAGAGGGAAGGAGG - Intergenic
1041349040 8:56930225-56930247 TTTTAGAAAAAGAAGGAAGTTGG - Intergenic
1041386797 8:57312787-57312809 CAGAAGGAAGAGAGTGAAGTAGG - Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1043282530 8:78485874-78485896 CAGTAGGAAAACAAGGAAATAGG - Intergenic
1044430157 8:92098978-92099000 CTGTGGAAAAAAAGTGAAGTTGG + Intronic
1044552126 8:93524362-93524384 GTGGTGGAAAAGATGGAAGTTGG - Intergenic
1045042890 8:98243802-98243824 CTGTAGAATAAGAGGTAAATGGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045319211 8:101069028-101069050 TGGAAGGCAAAGAGGGAAGTGGG + Intergenic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045509637 8:102804978-102805000 CTGAAGGAAAATGTGGAAGTTGG + Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1048117924 8:131545854-131545876 CTGGAGGAGAAGGAGGAAGTGGG + Intergenic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050214069 9:3302139-3302161 CTGTATTAAAATATGGAAGTAGG + Intronic
1050390650 9:5140609-5140631 CTGTAGGAAATGGAGAAAGTTGG - Intronic
1050802306 9:9630407-9630429 GTGTAGGAAAAGTGGGACATTGG - Intronic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1051180188 9:14403545-14403567 CTTTAGGAAAAAAGAGAAATGGG - Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052431476 9:28372148-28372170 CTGTAGCAAAATTGTGAAGTTGG - Intronic
1052993306 9:34535402-34535424 ATGAAGGAAAAGAGGGAAGGAGG - Intergenic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053202606 9:36163216-36163238 GTTTAAGAAAAGAGGGAAGGGGG - Exonic
1054746826 9:68862491-68862513 CTATAAGAAAAGCTGGAAGTGGG + Intronic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056926707 9:90840384-90840406 CTGCAGGAAAAGGGTGGAGTGGG + Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057925489 9:99143560-99143582 CTGTATGTAAAGTGGGGAGTGGG - Intronic
1058115131 9:101076918-101076940 TCATAGGAAAAGAGGGAAGTAGG - Intronic
1058342654 9:103917773-103917795 TTGGAGAAAAAGAGGAAAGTGGG - Intergenic
1059151503 9:111953543-111953565 GTGAAGGAAAAGAGGAAAATGGG + Intergenic
1059504480 9:114785746-114785768 CTGTAGGACAACATGGAAGTGGG - Exonic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1060750471 9:126165279-126165301 CTGCAGGAACAGGAGGAAGTGGG - Intergenic
1061060884 9:128250088-128250110 GAGTAGGCAAAGAGGGAAGGAGG - Intronic
1061814247 9:133184365-133184387 CTCAGGCAAAAGAGGGAAGTTGG + Intergenic
1185787337 X:2901980-2902002 CTTTATGAAAAGAGGAAATTTGG + Intergenic
1185963622 X:4574999-4575021 CTATAGAAAAAGAGGGAACAAGG + Intergenic
1186631225 X:11351109-11351131 CAGGAGGAAATGAGAGAAGTGGG - Intronic
1187008804 X:15258946-15258968 CTGTATGGAAAGAGGGGAATGGG + Intronic
1187621605 X:21062425-21062447 AAGCAGGAAAAGAGGGAGGTAGG + Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188802222 X:34546605-34546627 CAGAAGGAAAAGAGAGAAGGGGG + Intergenic
1189330838 X:40144072-40144094 CTGGAGGGGAAGAGGGAAGGTGG + Intronic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1190067386 X:47250794-47250816 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1190446135 X:50526252-50526274 CTGTAGGAAACACGGGAAGGAGG + Intergenic
1192217169 X:69168638-69168660 CAGTAGGAAAAGAGATAAATTGG - Intergenic
1192755239 X:74040229-74040251 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1192936861 X:75869565-75869587 CTGAAGGAAAAGAAGGAACGAGG - Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1194790737 X:98146267-98146289 AAGTAAGAAAAGAGGGAAGGAGG + Intergenic
1195409513 X:104554689-104554711 CTTTATGAAAAGAGTGAAGCAGG - Intergenic
1195935738 X:110124232-110124254 CTGGACGGAAAGAGGGAAGCAGG + Intronic
1197209828 X:123819479-123819501 TTGTAGAGAAAGAGGGAAGGGGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199771130 X:150976043-150976065 TTGAATGAAAAGCGGGAAGTGGG - Intergenic
1199897896 X:152141341-152141363 CGGTAGCAAGAGATGGAAGTAGG - Intergenic
1200575520 Y:4884438-4884460 CTGCAGGCAAAGAGAGAAGGAGG - Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic