ID: 1165144075

View in Genome Browser
Species Human (GRCh38)
Location 19:33720551-33720573
Sequence GATGGTGGACAGAGGCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165144075_1165144081 0 Left 1165144075 19:33720551-33720573 CCCATTGGCCTCTGTCCACCATC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1165144081 19:33720574-33720596 CAAAGCTTCTCTGCCAGCCCTGG 0: 1
1: 1
2: 4
3: 23
4: 289
1165144075_1165144086 19 Left 1165144075 19:33720551-33720573 CCCATTGGCCTCTGTCCACCATC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1165144086 19:33720593-33720615 CTGGCATCTGCTTACAGTGGAGG 0: 1
1: 1
2: 3
3: 30
4: 302
1165144075_1165144087 20 Left 1165144075 19:33720551-33720573 CCCATTGGCCTCTGTCCACCATC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1165144087 19:33720594-33720616 TGGCATCTGCTTACAGTGGAGGG 0: 1
1: 0
2: 5
3: 74
4: 614
1165144075_1165144088 21 Left 1165144075 19:33720551-33720573 CCCATTGGCCTCTGTCCACCATC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1165144088 19:33720595-33720617 GGCATCTGCTTACAGTGGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 153
1165144075_1165144083 16 Left 1165144075 19:33720551-33720573 CCCATTGGCCTCTGTCCACCATC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1165144083 19:33720590-33720612 GCCCTGGCATCTGCTTACAGTGG 0: 1
1: 0
2: 1
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165144075 Original CRISPR GATGGTGGACAGAGGCCAAT GGG (reversed) Intronic
900378958 1:2374183-2374205 GAAATTGGACAGAGGCCACTTGG + Intronic
902607629 1:17577574-17577596 AATGGTGGCCACAGGCCTATGGG + Intronic
903004027 1:20286641-20286663 GATGGGGGACAGGGGCCTAGGGG - Intergenic
903006706 1:20303480-20303502 GATGCTAGGCAGAGGCCCATGGG + Intronic
904463943 1:30697025-30697047 GATGGAGGAGAGAAGCCAAGAGG - Intergenic
905594851 1:39197903-39197925 AATGGTGGACAGATGCCAAGTGG + Intronic
907303276 1:53501205-53501227 GATGGGGGACAGAGCGCAAATGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912587221 1:110778100-110778122 GATGGGGAACAGAGGCTAAAAGG + Intergenic
912918671 1:113843509-113843531 GATGGTTGCCAGGGGCCAGTGGG + Intronic
914998849 1:152569025-152569047 CATGGAGGACAGAAGCCAGTTGG - Intronic
915289222 1:154871631-154871653 GGAGCTGGACAGAGGCCAAAGGG - Intergenic
920011785 1:202873420-202873442 GATGGTGGGCATAGGCCAGAAGG + Intergenic
1063734381 10:8735698-8735720 GATGGTGGACAGGGAGCATTGGG + Intergenic
1069719303 10:70539543-70539565 GAGGGAGGACACAGGCCACTGGG - Intronic
1070288659 10:75100810-75100832 GATGGGAGACAGAGGCAAACGGG - Intronic
1070313242 10:75288708-75288730 GATGCAGGACAGTTGCCAATGGG + Intergenic
1070921034 10:80186526-80186548 GATGGTGGAGGGAGGCCACCGGG + Intronic
1072496631 10:95967754-95967776 TATGGTCGAAAGAGGCCAACAGG + Intronic
1074540786 10:114363720-114363742 GTTGGAGGACAGAAGCCAAATGG - Intronic
1076676735 10:132150995-132151017 GATGGTGGATAGAGGACAGATGG - Intronic
1076926141 10:133488890-133488912 GATTGTGGACACAGGGCCATTGG + Intergenic
1082075632 11:47973941-47973963 GCTGGGGCACAGAGGCCAGTGGG + Intergenic
1084494002 11:69493636-69493658 GATGGAGGACGGAGGACATTGGG - Intergenic
1085253979 11:75161978-75162000 TCTTGTGGACAGAGGCCCATGGG - Intronic
1087270363 11:96105118-96105140 AATGCTGGAAAGAGGCCAAATGG + Intronic
1091327347 11:134701075-134701097 GATGGTGGAGGGAGGGCAAGAGG + Intergenic
1095891012 12:47235243-47235265 GCTGGTGGACGGAGGCCAGCGGG + Exonic
1096176746 12:49526264-49526286 GATAGAGGAGAGAGGCCAACTGG - Exonic
1098861345 12:75714166-75714188 GATGGATGACAGAGTTCAATAGG - Intergenic
1100368958 12:93947566-93947588 GATGGTGCACAGAGTCCATCTGG + Intergenic
1101646982 12:106640551-106640573 AATGATGGAAAGAGGCCAAAAGG - Intronic
1101696388 12:107131282-107131304 GATCCTGGGCAGAGGCCACTGGG + Intergenic
1101765966 12:107699656-107699678 GGTGGTGGAGAGAGGGCACTTGG - Intronic
1103166718 12:118776206-118776228 GATCATGGCCCGAGGCCAATGGG + Intergenic
1105742988 13:23348384-23348406 GATGGGGCGCAGAGGCCAAAAGG - Intronic
1106140169 13:27005406-27005428 GAGGGTGGGCAGAGGCCAGTGGG - Intergenic
1106516054 13:30455078-30455100 AGTAGTGGACAGAGGCCCATAGG - Intergenic
1108032819 13:46254333-46254355 GATGTTGGAAAGAAACCAATAGG + Intronic
1113543918 13:111131644-111131666 CAGGGTGGTCAGAGGCCATTAGG + Intronic
1116999643 14:51359392-51359414 GATAGAAGACAGAGGACAATCGG + Intergenic
1120957104 14:90092501-90092523 CATGGAGGACAGAGGTCAAAGGG + Intronic
1121026642 14:90621112-90621134 GATGATGGGCAGAGGCCACACGG + Intronic
1122231444 14:100307998-100308020 GATGGGGGAGAGTGGCCCATGGG + Intergenic
1123092047 14:105746262-105746284 GAAGGTGAACAGGGGCCAGTGGG - Intergenic
1123448336 15:20345253-20345275 GATGGTGGAGAGAGGCAGAAAGG - Intergenic
1124355726 15:28993483-28993505 GGTGGTGGACAGGGGCCCAGAGG + Intronic
1125613015 15:40985300-40985322 AATGGTGGATAGGGGCTAATGGG - Intronic
1127612228 15:60648007-60648029 GATGGAGAACACAGGCCAAAGGG + Intronic
1128806210 15:70532951-70532973 GATGGTGGGGAGACGCCAAGGGG + Intergenic
1130026259 15:80273080-80273102 GCTGGGGGACACAGGCCCATGGG + Intergenic
1131182645 15:90250934-90250956 GATGTTGAAGGGAGGCCAATGGG - Intronic
1132663416 16:1071384-1071406 GATGGTGGGCAGAGGCTGAGGGG + Intergenic
1135196798 16:20401661-20401683 GCTGGAGGACAGAGGACACTGGG + Intronic
1136609920 16:31360000-31360022 GCTGGTGAACAGAAGCCAACAGG - Exonic
1137687007 16:50393253-50393275 GAGGGAGGACAGATGCCCATGGG - Intergenic
1138971152 16:62145237-62145259 GAGGGTGGACTCAGTCCAATTGG + Intergenic
1139149447 16:64363166-64363188 GTTTGTGGACAGTGGCTAATAGG + Intergenic
1139527667 16:67526825-67526847 AGGGGTGGGCAGAGGCCAATTGG + Intronic
1140265633 16:73418116-73418138 AAAGATGGACAGAGGCCACTGGG + Intergenic
1141848761 16:86629834-86629856 GATGGTGGAGAGAGGGGTATTGG + Intergenic
1145990705 17:29077776-29077798 GATGGTGGGCTGAGGGCATTGGG + Exonic
1148686020 17:49501739-49501761 GAAGGTGGCCAGAGGCCCAGCGG - Intronic
1149213187 17:54326773-54326795 GATGGTGGCCAGAAACAAATAGG + Intergenic
1151339946 17:73464753-73464775 GATGGTGGAGGGTGGCCATTGGG - Intronic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1152738971 17:82010895-82010917 GATGGGGGGCAGGGGCCCATGGG + Intronic
1156864195 18:41870473-41870495 GTGGATGGACACAGGCCAATGGG - Intergenic
1157552231 18:48589779-48589801 GATGGAGGACAGAGGTCACCTGG + Intronic
1158715535 18:59875886-59875908 GATGGTTGCCAGGGGCCAAGGGG - Intergenic
1160174334 18:76580342-76580364 GGTGGTGGTCAGTGGCCAACGGG + Intergenic
1160331497 18:77996173-77996195 AATGGTGAACAGAGGCAAAGAGG + Intergenic
1160812081 19:1017290-1017312 GAGGGTGGCCAGGGGCCCATGGG - Intronic
1162444837 19:10716474-10716496 GACAGTGGACAGAGACAAATAGG - Intergenic
1163687183 19:18718424-18718446 GAGGTTGGACAGAGCCCAAGAGG - Intronic
1164766592 19:30777229-30777251 GAAGGTGGACACAAGCCATTGGG - Intergenic
1165144075 19:33720551-33720573 GATGGTGGACAGAGGCCAATGGG - Intronic
1167384337 19:49155350-49155372 GAAGGTGGACAGAGACCGAAAGG - Exonic
1168061638 19:53896200-53896222 GATGGTGGGCAAAGGCCTAGAGG + Intronic
927204673 2:20599519-20599541 GATTGTGGACAGAGGTCAAAGGG + Intronic
929088777 2:38194417-38194439 AATGCTGAACAGAGGCCAAGAGG - Intergenic
932049123 2:68381421-68381443 AAAGGTGGTCAGAGGCCAACAGG + Intronic
932706857 2:74032647-74032669 GCCGGTGGACAGAGGCCAGCCGG - Intronic
934620273 2:95799314-95799336 GATGGTGGCCTGAGGCCAGGAGG + Intergenic
934640619 2:96025249-96025271 GATGGTGGCCTGAGGCCAGGAGG - Intronic
934729008 2:96644567-96644589 GACGGTGGATACAGGCAAATAGG + Intergenic
936039587 2:109140107-109140129 GACGGTGGACAGAGGGAAAAGGG - Intronic
937588774 2:123589122-123589144 GCTGAAGGACAGAGGCCAATTGG + Intergenic
938172099 2:129088414-129088436 GAGGCTGCACAGAGGCCAAGGGG - Intergenic
938669145 2:133570576-133570598 GAAGGTGGACAGAGTCTAAGAGG - Intergenic
941005842 2:160246101-160246123 CATGGTGGTCAGAGGCCAGGGGG + Intronic
944173327 2:196802523-196802545 GATCTGGGACAGAGGACAATAGG + Intergenic
944905802 2:204260827-204260849 GGTGGTGGACAGGGGGCAGTGGG - Intergenic
946418902 2:219553941-219553963 GCTGGGGGCCAGAGGGCAATGGG + Intronic
948879733 2:240850602-240850624 GATGGGGGTCAGAGGGCACTGGG + Intergenic
948902664 2:240964254-240964276 GATAGTGGACAGGGGCCATGCGG + Intronic
948930752 2:241130431-241130453 CTTGGTGGACAGAGGCCACGTGG - Intronic
1168789443 20:566333-566355 GATGGTGCACAGAGGAGAATGGG + Intergenic
1169989996 20:11491739-11491761 GCTGGTAGATAGAGGCCAGTTGG - Intergenic
1172893470 20:38283473-38283495 GATGGTGGACGGAGGGCATGGGG + Intronic
1174624935 20:51906214-51906236 TCTTGTGGACACAGGCCAATGGG + Intergenic
1174852167 20:54006060-54006082 GATGGTGGGCACAGGGCAAAGGG + Intronic
1184557024 22:45239125-45239147 AAAGGTGGTCAGAGGACAATAGG + Intronic
949930071 3:9071500-9071522 GAGGGTGGGGAGAGGCTAATGGG + Intronic
952162650 3:30709551-30709573 GATGGTGGAAAAAGGGAAATGGG - Intergenic
952974908 3:38685492-38685514 AATGGTGGAGAGAAGGCAATGGG + Intergenic
953542636 3:43835712-43835734 GCTGGTGGACAGAGAACAAAAGG + Intergenic
954687200 3:52377364-52377386 GGTGGTGAACAGTGGCCGATTGG - Intronic
959076437 3:101753906-101753928 GACGGTGGGCAGAGGACAGTGGG - Intronic
960353537 3:116622688-116622710 GATGGTTGCCAGAGGCCAGCAGG - Intronic
964251141 3:154719149-154719171 GAAGGTTGACAGGGGCCAGTAGG + Intergenic
967842730 3:194019791-194019813 GATGGTGGACAAGGGCCAGATGG - Intergenic
968594670 4:1476258-1476280 GATGGTGGACAGATGACACATGG + Intergenic
968742820 4:2339957-2339979 GAAGGTGGACTGAGGCCCTTGGG + Intronic
969198145 4:5579504-5579526 GATGGTGGCCAGTGGTCCATAGG + Intronic
969618174 4:8265659-8265681 GAAGGTGGACAGAGGCCGAGCGG + Intergenic
969684528 4:8663549-8663571 GGGGGTGGACAGAGGAGAATGGG + Intergenic
972364329 4:38360152-38360174 GCTGGAGGAGAGAGGCCAGTGGG - Intergenic
974449152 4:62028746-62028768 GGTGGGGGACAGAGGCCTTTGGG + Intronic
977335043 4:95687167-95687189 GAAGGGGCACAGATGCCAATTGG - Intergenic
981875120 4:149532930-149532952 GATGGAGGGCAGAGGTCAGTGGG + Intergenic
982069823 4:151685490-151685512 GAGGGTGGAAAGAGGCCAAGAGG - Intronic
985631662 5:1017251-1017273 GATGGTGGGCAGAGGGACATGGG - Intronic
986459908 5:7959678-7959700 GGTGCTGGGCAGAGGCCAAGAGG + Intergenic
992407412 5:76472673-76472695 TATGTTGGACAGGTGCCAATCGG + Intronic
993200031 5:84803908-84803930 ACTGGTGGACAGAGGGTAATTGG + Intergenic
998326764 5:141287762-141287784 TATGGTGGTCAGATGCCCATGGG + Intergenic
1001799682 5:174532181-174532203 AATGGTAAACAAAGGCCAATGGG - Intergenic
1003542615 6:7031834-7031856 GATAATGGAAAGAGGCCGATTGG - Intergenic
1004871650 6:19911009-19911031 GATGATGGACAGAGGAGAATAGG + Intergenic
1010308383 6:74351681-74351703 GATTGTGAACAGAGACCCATGGG + Intergenic
1010889698 6:81291357-81291379 GATGGTGGAGAGAGAGCAATGGG + Intergenic
1011634911 6:89362701-89362723 GGTGGTTGAGAGAGGCCACTCGG + Intergenic
1012631776 6:101478840-101478862 GATGGTGGAATGAGGCAAAATGG - Intronic
1014878466 6:126691042-126691064 AATGGAGGATAGAGGACAATGGG + Intergenic
1017502452 6:155038240-155038262 GATGGTGGTCAGAAGGCACTAGG - Intronic
1018558533 6:165075298-165075320 TATGGTGGAAAGAGGGCAAGAGG + Intergenic
1019253400 7:33027-33049 GGTGGAGGACAAAGGCCTATGGG - Intergenic
1021247127 7:18277278-18277300 GATGGAGGACACTGGCCAAGTGG + Intronic
1026245951 7:68619864-68619886 GGTGGTGGGCAGAGCCCAAGTGG - Intergenic
1031756676 7:125652390-125652412 GATGGTGGAGAAAAGCCTATAGG + Intergenic
1032090543 7:128909592-128909614 GATGGTGGAGAGAGGAGAAGGGG - Intronic
1032369849 7:131337662-131337684 GATGATGGAAATAGGCCTATAGG - Intronic
1032606096 7:133355271-133355293 GATGGAGGACAGAGGTGGATGGG + Intronic
1035307317 7:157941803-157941825 GAAGGTGGGCAGAGGCCTCTGGG - Intronic
1035496140 7:159328326-159328348 GATGGAGGCCAGAAGACAATGGG + Intergenic
1036337377 8:7882939-7882961 TTTGGTGGACAGATGCCATTTGG - Intergenic
1037823192 8:22145512-22145534 CATGGTGGGCAGAGGCTCATGGG + Intergenic
1040661810 8:49583127-49583149 GATGGTGGCAAGAGGCAGATGGG + Intergenic
1043821458 8:84870834-84870856 GAAAGTGGACTAAGGCCAATTGG + Intronic
1044923031 8:97185822-97185844 GAGGGAGGACAGTGGGCAATGGG + Intergenic
1046295725 8:112217366-112217388 GATTGTGGAAATAGACCAATAGG - Intergenic
1050152244 9:2628452-2628474 GATGGTGGGTAGTGACCAATAGG + Intronic
1051899588 9:22024653-22024675 GGTGGTTGACAGAGGTCAAGGGG + Intronic
1053586074 9:39460323-39460345 TATGGAGGACAGAGGGCAATGGG + Intergenic
1053597861 9:39581963-39581985 GACTGTGAACAGATGCCAATGGG - Intergenic
1054580235 9:66904906-66904928 TATGGAGGACAGAGGGCAATGGG - Intronic
1055559518 9:77508847-77508869 GATGCTGGAAATTGGCCAATAGG - Intronic
1056699287 9:88888880-88888902 CATGGTGGACAGTGGCCCCTTGG + Intergenic
1056965748 9:91161704-91161726 GTTGGGGGACAGAGGCTGATTGG + Intergenic
1062324172 9:136004492-136004514 GGTGGTGGACACAGGCCTCTTGG - Intergenic
1062746970 9:138219342-138219364 GGTGGAGGACAAAGGCCTATGGG + Intergenic
1186467793 X:9797619-9797641 GGAGGTGGAAAGACGCCAATGGG - Intronic
1187249563 X:17584431-17584453 GATGGTGAACAAACACCAATAGG - Intronic
1187960161 X:24560387-24560409 GATGGAAGACAGAGACCAAATGG + Intronic
1189451577 X:41137208-41137230 GAGGCTGGACAGAAGACAATGGG - Intronic
1190919843 X:54841003-54841025 GGTGGTGTGCAGAGGCCACTGGG + Intergenic
1192590766 X:72357613-72357635 GAGGGTGGGCAGAGGCCTAATGG + Intronic
1195322258 X:103729326-103729348 GATGGAGGACAGAGGCAGAGGGG + Intergenic
1195410573 X:104565104-104565126 GGTGGTGGACCGAGGCCAAGCGG + Intergenic
1196528739 X:116758778-116758800 CCAGGTTGACAGAGGCCAATTGG + Intergenic
1198111712 X:133508022-133508044 GATGGGGGTCAGGGGCCAATGGG + Intergenic
1201144448 Y:11056049-11056071 TACTGTGGACAGAGGCCCATTGG + Intergenic
1201784381 Y:17757975-17757997 GATGGTGGACATGGGCCAGAAGG - Intergenic
1201817172 Y:18148012-18148034 GATGGTGGACATGGGCCAGAAGG + Intergenic