ID: 1165144227

View in Genome Browser
Species Human (GRCh38)
Location 19:33721288-33721310
Sequence CAGAAGATGGAGAAGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 491}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165144227_1165144236 15 Left 1165144227 19:33721288-33721310 CCCCAGTCCTTCTCCATCTTCTG 0: 1
1: 0
2: 3
3: 42
4: 491
Right 1165144236 19:33721326-33721348 CATCCTCCAGGACAGAGCCCAGG 0: 1
1: 0
2: 5
3: 50
4: 405
1165144227_1165144233 -8 Left 1165144227 19:33721288-33721310 CCCCAGTCCTTCTCCATCTTCTG 0: 1
1: 0
2: 3
3: 42
4: 491
Right 1165144233 19:33721303-33721325 ATCTTCTGTCCTCTGAGATCGGG 0: 1
1: 0
2: 1
3: 23
4: 231
1165144227_1165144235 3 Left 1165144227 19:33721288-33721310 CCCCAGTCCTTCTCCATCTTCTG 0: 1
1: 0
2: 3
3: 42
4: 491
Right 1165144235 19:33721314-33721336 TCTGAGATCGGGCATCCTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1165144227_1165144232 -9 Left 1165144227 19:33721288-33721310 CCCCAGTCCTTCTCCATCTTCTG 0: 1
1: 0
2: 3
3: 42
4: 491
Right 1165144232 19:33721302-33721324 CATCTTCTGTCCTCTGAGATCGG 0: 1
1: 0
2: 2
3: 36
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165144227 Original CRISPR CAGAAGATGGAGAAGGACTG GGG (reversed) Intronic
901831031 1:11892590-11892612 CAGAAGCTGGAGATGAGCTGGGG - Intergenic
901859672 1:12066250-12066272 CAGAAGTGGGAGAAGGCTTGAGG - Intronic
902679636 1:18033916-18033938 CAGATGATTGAGCAGGGCTGGGG + Intergenic
902828272 1:18992495-18992517 GATAAGATGGAAAAGGCCTGGGG - Intergenic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
904372398 1:30058119-30058141 GAGGAGATGGAGAATGAATGAGG - Intergenic
904413734 1:30342322-30342344 CAGAAGACGGTGAAGAAGTGAGG - Intergenic
904621292 1:31776869-31776891 GAGAAGATGGGGAAGATCTGGGG + Intergenic
904948998 1:34220790-34220812 CAGACCATGCATAAGGACTGTGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905984795 1:42270150-42270172 AAGAAGATGGAGTAAGGCTGGGG - Intronic
906516394 1:46441252-46441274 CAGAAGCTGGGGCAGGACTCAGG - Intergenic
906669766 1:47645875-47645897 AGGGAGATGGAGAGGGACTGGGG + Intergenic
907827321 1:58031331-58031353 CAGTAGATGAAGCAGAACTGTGG + Intronic
908305043 1:62804702-62804724 CCTAAGATGGAGAAGTACTTGGG + Intronic
908424622 1:63994553-63994575 CAGACAATGGAGAAGGCTTGTGG + Intronic
908466714 1:64403108-64403130 CAGAAGATGGAGGGGGCATGTGG + Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909739613 1:79011603-79011625 CCGTGAATGGAGAAGGACTGAGG + Intergenic
911506912 1:98764146-98764168 CAGAAGAAAGAAAAGTACTGGGG + Intergenic
912770294 1:112457256-112457278 TAGCAGATGGAGAAGGGGTGAGG - Exonic
913430607 1:118787256-118787278 CTTAAGATGGAGAAGATCTGTGG + Intergenic
913441547 1:118903644-118903666 TAGAAGATGGAAAAGGACTAAGG + Intronic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914913601 1:151804986-151805008 CAGAGGAAGGGGAAGCACTGGGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916789512 1:168112937-168112959 CAGAAGACAGAGGAGGAATGTGG + Intronic
917750295 1:178047108-178047130 CAGAAGCTGGTGGAGGGCTGAGG + Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
919039428 1:192364165-192364187 CAGAAGATGGTGCAGGGCAGTGG - Intronic
919770040 1:201152255-201152277 AAGAAGTTGGAGAAGGAATGTGG - Intronic
919850052 1:201666513-201666535 AAGAAGAGCAAGAAGGACTGAGG + Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920071151 1:203304321-203304343 GAGAAAAGGGAGGAGGACTGAGG + Intergenic
920336168 1:205246871-205246893 CGGAAGCTGGTGAAGGACTGTGG + Intronic
920362327 1:205427767-205427789 CATGAAATGGAGAAGGAATGAGG + Intronic
920392763 1:205620391-205620413 CTGAAGATGGAGAAATACTTGGG + Exonic
920431628 1:205922541-205922563 CAGAAAATGGAGAAGGGCCTTGG + Intronic
920843764 1:209576569-209576591 CAGAAGAGGGAGATGGGCGGTGG + Intergenic
921174634 1:212583484-212583506 CAGGGGATGGTGAAGCACTGAGG + Intronic
921302890 1:213767388-213767410 CAGAAGATGGGGAGGAAATGTGG - Intergenic
921998776 1:221452445-221452467 CTACAGATTGAGAAGGACTGGGG - Intergenic
923227036 1:231947959-231947981 CAGATGCTGGAGAGGGAGTGGGG + Intronic
1062964750 10:1598678-1598700 CAGAAGATGCAGAAGGCCCCAGG + Intronic
1063861304 10:10310747-10310769 CAGAGGAGAGGGAAGGACTGAGG + Intergenic
1065480830 10:26192545-26192567 CAGAGGATGGATAAGGTCAGGGG - Intronic
1067149072 10:43714807-43714829 CAGAAGATGGAAGAGCACTTTGG - Intergenic
1067661433 10:48238793-48238815 CAGATCAGGGAGAAGAACTGTGG - Intronic
1067796374 10:49325065-49325087 CAGAAGATGGTGAGGGAGTAAGG - Exonic
1067824728 10:49562448-49562470 AAGAATCTGGAGAATGACTGTGG - Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1070646081 10:78203361-78203383 CGGAAGAGAGAGCAGGACTGGGG + Intergenic
1072044541 10:91641594-91641616 AAGAAGATGAAGAAGAACAGAGG + Intergenic
1072165666 10:92810435-92810457 CAGAAGAGGGTCAAGGAGTGTGG - Intergenic
1072233988 10:93437795-93437817 CAGGAGAGGGAGAAGTGCTGGGG - Intronic
1073007154 10:100333266-100333288 CAGAGGAGGGGGAAGGCCTGAGG + Intergenic
1073480674 10:103784363-103784385 CTGGAGGTGGAGAAGGGCTGGGG - Intronic
1073493527 10:103871377-103871399 CAGAAGCTCTAGCAGGACTGGGG - Intergenic
1075514524 10:123098406-123098428 CACAACAGGGAAAAGGACTGAGG + Intergenic
1075728599 10:124623240-124623262 GAGCAGATAGAGAAGAACTGAGG - Exonic
1075834977 10:125445361-125445383 AGGAAGATGTAGATGGACTGGGG - Intergenic
1076356925 10:129860140-129860162 CAGGAGATGGTGTGGGACTGTGG - Intronic
1076492801 10:130874722-130874744 CAGATCTTGGAGAATGACTGTGG + Intergenic
1076997628 11:306457-306479 CAGCAGAAGGAGGAGGACTTAGG + Intergenic
1077284816 11:1760927-1760949 AAGAAGATGGGGAGGGGCTGGGG + Intronic
1077308616 11:1878736-1878758 CAGAACAGGGAGCAGGGCTGGGG - Intronic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077693184 11:4368033-4368055 CAGAAGATAGCTAAGGCCTGAGG + Exonic
1077695886 11:4392831-4392853 CAGGAGATGGATGAGCACTGAGG - Intronic
1078496128 11:11818909-11818931 GAGAGGAAGGAGAAAGACTGTGG - Intergenic
1078927834 11:15890396-15890418 CAGAGGAGGGAGAAGGGCTTTGG - Intergenic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080161877 11:29186103-29186125 AGGAAGATGGAGAATGACAGAGG - Intergenic
1080932552 11:36827192-36827214 CAGAAGCTGGAGTAGAACAGTGG - Intergenic
1081524246 11:43913940-43913962 CAGAAGAGGGGGCAGCACTGGGG + Intronic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1083607336 11:63986733-63986755 CACACGATGGAGAAGGGCCGCGG - Intronic
1083725028 11:64623433-64623455 GAGAAGATGGGGATGGACTGAGG - Intronic
1083793285 11:64999735-64999757 CAGAGTGTGGAGCAGGACTGAGG - Intergenic
1084190477 11:67496357-67496379 CAGAAGACAGAGAAAGATTGTGG + Intronic
1085040529 11:73323952-73323974 GAGAACAGGGAGAAGGACAGAGG - Intronic
1085211532 11:74784454-74784476 CAGTAGAGGGAGAAGGTGTGTGG + Intronic
1085227893 11:74939020-74939042 TAGAAAATGTAGAAGGAATGAGG - Intronic
1085520025 11:77132242-77132264 CAGAGAAAGGAGGAGGACTGTGG - Intronic
1087932258 11:103991327-103991349 AAGAAGATGGAGAAGGGAGGAGG - Intronic
1088565921 11:111173013-111173035 AAGAAGAAGGAGAAGTACAGTGG + Intergenic
1088700671 11:112408460-112408482 CATAAAATGGGGAAGGACTTAGG - Intergenic
1088783701 11:113161812-113161834 GAGAAGGTGGAGAAGCACTGTGG + Intronic
1089323420 11:117641656-117641678 CAGAAGAGGGAGACAGACTCGGG + Intronic
1089406426 11:118201355-118201377 GACAATATGGAGAAGGACAGAGG + Intronic
1089542088 11:119195423-119195445 CAGAAGAAGAAAAAGAACTGGGG - Exonic
1089750481 11:120648007-120648029 CAGAAGAGGGAAAAAGGCTGTGG - Intronic
1090234000 11:125133081-125133103 CTGAAGAGGGTGAAGGACTCTGG + Intergenic
1090272008 11:125393409-125393431 GAGAATATGGAGAAGGTCCGAGG + Intronic
1090393132 11:126402468-126402490 AAGAAGAAGAAGAAGAACTGAGG + Intronic
1091036472 11:132238270-132238292 CATAAGATGGGGGAGGATTGTGG + Intronic
1091077880 11:132637991-132638013 ATGAAGTTGGAGAAGGACTTAGG + Intronic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091559781 12:1603183-1603205 CAGAAGATGGAGGGGGGCGGGGG - Intronic
1092065968 12:5589851-5589873 CAGGACATGGAGAAGGACCTAGG + Intronic
1092089439 12:5792310-5792332 AACAAAATGGAGAAGGAGTGAGG - Intronic
1092570089 12:9711722-9711744 AAGAAGAGGTACAAGGACTGGGG - Intergenic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1093113981 12:15186922-15186944 CAGAAAATGGAGGAGAACTTGGG + Intronic
1093819982 12:23603109-23603131 AATAATATGGAAAAGGACTGGGG + Intronic
1094165395 12:27437841-27437863 CAAAAGAGGGAGACAGACTGAGG - Intergenic
1095432188 12:42145552-42145574 AAGAAGAGGGAGAAGAACTGGGG - Intergenic
1095659089 12:44708067-44708089 GAGAAGAACCAGAAGGACTGTGG + Intronic
1096069670 12:48768023-48768045 CAGAGGAGGGAGAAGCTCTGGGG - Exonic
1096312973 12:50537775-50537797 CAGAAGTAGGAGGTGGACTGGGG + Intronic
1096583885 12:52606870-52606892 GAGGAGATGGAGCAGGACAGAGG - Intergenic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1096970838 12:55665038-55665060 GAGAAGATGGGGAAGCACTGTGG - Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1098968081 12:76815961-76815983 CAGAAGAAGGCTAATGACTGTGG - Exonic
1099195754 12:79613843-79613865 CAGAAAATGGACAAGGCCGGGGG + Intronic
1099470091 12:83037314-83037336 TAGAAGATGGTAATGGACTGAGG + Intronic
1099717441 12:86314138-86314160 AAGAAGATGGAGAGTGAATGGGG - Intronic
1099909623 12:88813680-88813702 CAGAATATGGAGAAAGACCAGGG - Intergenic
1100168287 12:91943480-91943502 GAGAAAATGGAGGATGACTGTGG + Intergenic
1101040642 12:100751854-100751876 TTGAAGATGGGGAAAGACTGAGG + Intronic
1101845295 12:108358660-108358682 AAGAAGAAAGAGAAGGGCTGGGG + Intergenic
1102610943 12:114111831-114111853 CAGAAGAGGTAGAAAAACTGAGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1105324153 13:19355065-19355087 CAAAATCTGGAGAAGGCCTGTGG - Intergenic
1105869110 13:24488335-24488357 CAAAATCTGGAGAAGGCCTGTGG + Intronic
1106143650 13:27033247-27033269 GGGAAGATAGAGAGGGACTGAGG + Intergenic
1106647848 13:31656030-31656052 CAGAAGATGGCGCAGGGCAGTGG + Intergenic
1108698615 13:52924988-52925010 GAGAAGATGGAGAGGAAATGTGG - Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1110467949 13:75824488-75824510 CATCAGATGAAGAATGACTGGGG + Intronic
1110738338 13:78964794-78964816 CGTAAGATGGAGAAGGTGTGTGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112769524 13:102780701-102780723 AAGAAGATGCAGATGAACTGGGG - Intergenic
1112885635 13:104167808-104167830 CAGAAGCTGGAGGAGGATTTGGG + Intergenic
1113261632 13:108571264-108571286 CAGAGGATGGCTCAGGACTGAGG + Intergenic
1113651462 13:112036704-112036726 CAGAAGAGGGTGGAGGACAGGGG - Intergenic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114338777 14:21721074-21721096 CAGCAGATAGAGAAGGATTCAGG - Intergenic
1114649701 14:24276662-24276684 CGTAAGATGGAGTAGGACAGGGG + Intergenic
1115058243 14:29157098-29157120 GAGAACAAGAAGAAGGACTGTGG + Intergenic
1116822770 14:49641540-49641562 CAGATGGTGGTGAATGACTGGGG + Intergenic
1117430704 14:55657104-55657126 CATGAGAGGGAGAAGGAATGTGG - Intronic
1117634784 14:57730286-57730308 GAGAAGATGGAGAAAGATGGTGG - Intronic
1118435207 14:65765011-65765033 CTGAAGGTGGAGAAGGACAGCGG + Intergenic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1120107875 14:80516810-80516832 CAGAAGTTGGGGGAGGAGTGGGG + Intronic
1120750643 14:88194631-88194653 GGGAAGATGGGGAAGGACAGCGG + Intronic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121319276 14:92981584-92981606 CATAAGAAGGAGATGCACTGGGG - Intronic
1121701954 14:95961412-95961434 CAGAAGCTGGAAGAGGAATGGGG + Intergenic
1122207642 14:100156046-100156068 CAGGAGCTGGAGATGGACTTTGG + Intronic
1122360035 14:101153641-101153663 AAGAAGAAGGAAGAGGACTGGGG - Intergenic
1122433001 14:101667918-101667940 GAGAAGATAAAGAAGGACTGAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1125918438 15:43510077-43510099 CAGAGGTTGGGAAAGGACTGAGG - Intronic
1126447947 15:48771033-48771055 AAGAAGAGGGAAAAGGAATGTGG - Intronic
1127037440 15:54933461-54933483 CTGAAGTTGGAGGAGGGCTGAGG + Intergenic
1127775634 15:62262241-62262263 GAGGAGCTGGAGGAGGACTGTGG + Intergenic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129654599 15:77515785-77515807 CAGAGGTTTGAGAAGGAATGTGG + Intergenic
1129706547 15:77797809-77797831 CAGAAGATGGAAAAGCCCTCAGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130893925 15:88156282-88156304 GAGGAGGTGGAGAAGGACCGTGG + Intronic
1131228473 15:90643977-90643999 CAGAAGATAGAAATGGAATGAGG - Intronic
1131636540 15:94238761-94238783 AAGGAGATGGAGAAGCACAGAGG + Intronic
1131983279 15:98016783-98016805 TAGAAGAGGGAGAGGGTCTGAGG - Intergenic
1132065219 15:98725481-98725503 CAGGAGTTGGAGAAGCACTGTGG - Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133415481 16:5603764-5603786 CACAAGATGGAGAGGCACTTGGG + Intergenic
1135271901 16:21076985-21077007 CAAAAGATGGGGCAGGGCTGGGG - Intronic
1135791391 16:25399952-25399974 CAGGAGATGGAGAATTCCTGGGG - Intergenic
1136062523 16:27736523-27736545 CAGAAGAAGGAGCAAGGCTGTGG + Intronic
1136085253 16:27880340-27880362 CAGATGATGGAATAAGACTGAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137692355 16:50437797-50437819 GAGAAGAGGGAGTAGGGCTGGGG - Intergenic
1137966570 16:52940055-52940077 CAGAAAAGGGAGAAGGCCTATGG - Intergenic
1137975065 16:53024260-53024282 GGGAGGATGGAGAAGGACAGGGG + Intergenic
1139691342 16:68643917-68643939 CAGAAGGTGAAGGAGGAGTGAGG + Intronic
1140573429 16:76135710-76135732 CAGAGGATGGAGATGGTCAGAGG + Intergenic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1140668263 16:77248001-77248023 CAGTCCATGAAGAAGGACTGAGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141733212 16:85835950-85835972 CAGATTCTGGAGCAGGACTGGGG + Intergenic
1141819711 16:86436896-86436918 CAGAGGATGGAGAACCCCTGCGG + Intergenic
1143130855 17:4676080-4676102 CCGAAGCTGGAGAAGGACATGGG + Exonic
1143343489 17:6232399-6232421 CAGCAGAGGGAGAGGGGCTGGGG + Intergenic
1144291208 17:13828246-13828268 CAGAAGATGAAGTAGGAATTAGG - Intergenic
1144335404 17:14264667-14264689 CAGAGGAAGGAGTAGAACTGGGG + Intergenic
1145751796 17:27360628-27360650 CAGAAGCTGGAGGAGGACTGTGG + Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1146902316 17:36596801-36596823 CAGCAGATGGGAAAGGATTGTGG - Intronic
1147359183 17:39920649-39920671 GAGAAACTGGAGAAGGGCTGGGG + Intergenic
1147411928 17:40259472-40259494 CAGAGGGTGGAAAAGGCCTGGGG + Intronic
1147699253 17:42381955-42381977 CAGAAAAGGGATAAGAACTGTGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148394016 17:47294361-47294383 CAGGCCATGGAGGAGGACTGGGG - Intronic
1148552219 17:48557327-48557349 CAGAAGAGGGAACGGGACTGGGG + Intronic
1148882990 17:50745941-50745963 CAGAAGATGCAGCAGGTCTCGGG + Exonic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149110655 17:53025416-53025438 CAGAAGAAAGAGAAGAAATGGGG - Intergenic
1149194067 17:54098774-54098796 GAAAAGATGAAGAATGACTGAGG + Intergenic
1149267161 17:54939396-54939418 CAGGAGATGGGGAAGAACAGGGG + Intronic
1149457258 17:56797986-56798008 TAGAAGATGGAGAGGGAAGGAGG - Intronic
1150582083 17:66483380-66483402 GTGAAGATGGAGAAAGACTGGGG - Intronic
1151345815 17:73500570-73500592 CAGAGGATGGAGGAGAACAGAGG - Intronic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1152205492 17:78972413-78972435 CAGCAGTTGGAGCAGGTCTGTGG + Exonic
1153643391 18:7174443-7174465 AAGAAGAAGAAGAAGGACCGTGG + Intergenic
1155365571 18:25046271-25046293 CAGGAGATGAAGAAGGAATCTGG + Intergenic
1156720782 18:40067410-40067432 CAGAGAATGGGGAAGGGCTGAGG + Intergenic
1156801418 18:41119322-41119344 CAGATGCTGGAAAAAGACTGTGG + Intergenic
1157257238 18:46150174-46150196 TAGAGGAAGGAGAAGGGCTGGGG - Intergenic
1157612969 18:48970056-48970078 CAGCTGAGGGAGAAGGAATGAGG - Intergenic
1157779366 18:50423803-50423825 CAGAAGGTAAAGAGGGACTGGGG - Intergenic
1159138521 18:64365235-64365257 CACAAGAGGAGGAAGGACTGGGG - Intergenic
1159954270 18:74508181-74508203 CAGAGGATGGAGGAGGCGTGGGG + Intronic
1160141299 18:76325553-76325575 CAGAAGGTGGAGAAGGCTTGTGG + Intergenic
1160695209 19:480571-480593 ACGATGATGGAGAAGGAATGTGG + Intergenic
1160695233 19:480697-480719 ACGATGATGGAGAAGGAATGTGG + Intergenic
1160695260 19:480887-480909 ACGATGATGGAGAAGGAATGTGG + Intergenic
1160695272 19:480937-480959 AGGATGATGGAGAAGGAATGTGG + Intergenic
1160695284 19:481014-481036 ATGATGATGGAGAAGGAATGTGG + Intergenic
1160695300 19:481102-481124 ACGATGATGGAGAAGGAATGTGG + Intergenic
1160695315 19:481164-481186 AGGATGATGGAGAAGGAATGTGG + Intergenic
1160695354 19:481365-481387 ACGATGATGGAGAAGGAATGTGG + Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161588736 19:5119139-5119161 CAGACACTGGAGAAAGACTGAGG + Intronic
1162552895 19:11367703-11367725 CAGAAGGTGGAGAAGCTCTCTGG + Intergenic
1162585031 19:11553235-11553257 TAGAAGGTGGAGAAGGAGAGCGG + Exonic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1165013341 19:32864188-32864210 CAGATGATGGCGAAGGACGTGGG + Exonic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165361076 19:35337434-35337456 CAGGAGATGGAGCAGGACTCTGG + Intronic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167717641 19:51154213-51154235 AAGGTGATGGAGAAGGGCTGGGG - Intergenic
1167784944 19:51629049-51629071 CTGAAGATGGTGATGGTCTGTGG + Exonic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168464953 19:56594889-56594911 GAGAGGATGGAGAGGGACTTGGG - Intergenic
925060306 2:885581-885603 GAGAAGACTGAGAAGGACTGGGG + Intergenic
925065872 2:928530-928552 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925065909 2:928731-928753 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925065921 2:928798-928820 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925186114 2:1847540-1847562 CAGGTGAAGGAGAAGGCCTGGGG + Intronic
925744440 2:7032534-7032556 CAGAAGCTGGACAAGGCCGGAGG - Intronic
925978007 2:9154690-9154712 GAGCAGGTGGAGAAGGACTCAGG - Intergenic
927103924 2:19808165-19808187 CAGAGGCTGGACAAGGACTGGGG + Intergenic
928902018 2:36329664-36329686 CAGAAGATGTAGAAGGACAGGGG - Intergenic
929918596 2:46156193-46156215 CAGATGACGGGGAAGGGCTGAGG - Intronic
930087477 2:47508041-47508063 CAGAAGACGGAGACAGATTGAGG + Intronic
930565586 2:53015286-53015308 CAGAAGATGGAGACTGTGTGAGG + Intergenic
931233151 2:60391219-60391241 CAGAGGAAGGGGAGGGACTGAGG - Intergenic
931787190 2:65630854-65630876 CAGCAAAGGGAGAGGGACTGGGG + Intergenic
932619328 2:73256580-73256602 CAGAACAGGGTGGAGGACTGAGG + Exonic
933464818 2:82639027-82639049 CAGAAGAGGGACAAGGCCTGTGG + Intergenic
933887859 2:86736820-86736842 CAGAAGAGGGAGTAAGTCTGTGG + Intronic
933922319 2:87059892-87059914 CAGAAGAGGGAGTAAGTCTGTGG - Intergenic
934101650 2:88659158-88659180 CAGATGGTGCATAAGGACTGAGG - Intergenic
934675195 2:96244885-96244907 TGGGAGATGAAGAAGGACTGAGG - Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
937617230 2:123940454-123940476 CAGATCATGGAGAAGAAATGAGG - Intergenic
938313877 2:130313516-130313538 CAAAAGTTGGAAAAGGGCTGGGG - Intergenic
938799192 2:134745109-134745131 AAGAAGATAGAGAGGAACTGTGG + Intergenic
939722731 2:145675119-145675141 CCGAAGAGGGAGACAGACTGGGG + Intergenic
940525721 2:154811198-154811220 CAGAAGATTTAGAAGGTATGGGG - Intronic
941496247 2:166207926-166207948 AAGAAGCTGGAGAAAAACTGAGG + Intronic
942606605 2:177698509-177698531 AAGATGCTGGAGAAGGAATGTGG + Intronic
942853807 2:180522584-180522606 TAGAACATGCAGAAGGAATGAGG - Intergenic
943353345 2:186821362-186821384 CAGAACTTTGAGAAGCACTGGGG + Intergenic
944300806 2:198123004-198123026 CAGACTGTGGACAAGGACTGCGG - Intronic
944534767 2:200697777-200697799 CAGTAGATGGAGGGGAACTGGGG + Intergenic
946529742 2:220558624-220558646 CAGACCATGGTGAGGGACTGGGG - Intergenic
947370435 2:229440267-229440289 ATGAAGATGGAGAATGGCTGTGG + Intronic
947811955 2:233010427-233010449 CAGGAGGAGGAGAAGAACTGGGG - Intronic
948157952 2:235799897-235799919 CAGAAGAAGAAGAGGGCCTGTGG - Intronic
948263985 2:236624399-236624421 CACTAGATGCAGAAGGCCTGGGG - Intergenic
948693901 2:239723078-239723100 CAGAAGGTGGACAGGGACGGTGG + Intergenic
948814417 2:240502580-240502602 CAGCAGATGGGGAGGGGCTGTGG - Intronic
1169135457 20:3194633-3194655 CCGAAGGTGGAGAAGGACCTGGG - Intronic
1169197461 20:3691265-3691287 CAGAAGAGGAGGAAGAACTGAGG + Intronic
1169621281 20:7509140-7509162 CAGGAGATGGAGCAGGGTTGGGG + Intergenic
1170930235 20:20762855-20762877 CAGGAGATGGAGAAGCACCCAGG - Intergenic
1171333810 20:24364869-24364891 CAGAATATGAAGAAGGACAGTGG - Intergenic
1172802978 20:37591302-37591324 CAGAAGATGTACAGGAACTGGGG - Intergenic
1172891296 20:38267545-38267567 GAGAAAATGGGGAAGGGCTGTGG + Intronic
1173029121 20:39338466-39338488 GACCTGATGGAGAAGGACTGAGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1177010501 21:15726157-15726179 CAGAAGATGAAGAGATACTGTGG + Intergenic
1177236288 21:18393072-18393094 CAGATGATGTGGCAGGACTGAGG + Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179154745 21:38840184-38840206 CACAGGGTGGAGAAGGACAGAGG - Intergenic
1179174676 21:38999852-38999874 CAGAAGATGGATAAGGACAAGGG - Intergenic
1179455367 21:41495837-41495859 CAGCAGATGCAGAAGCCCTGGGG - Intronic
1179988622 21:44934249-44934271 AAGAACATGGAGGAGGAATGTGG - Intronic
1180128799 21:45811379-45811401 CAGCAGGTGGAGGAGGACTCAGG - Intronic
1180924579 22:19544751-19544773 CAGGGGATGGAGAAGGGCTGGGG + Intergenic
1181413687 22:22744742-22744764 GAGAGTATGGAGAAGGCCTGAGG + Intronic
1182080636 22:27526442-27526464 CAGTAGCTAGGGAAGGACTGGGG + Intergenic
1184254545 22:43279695-43279717 CAGAAGCTGGACAGGGGCTGTGG - Intronic
1184742864 22:46439228-46439250 CGGAAGGTGACGAAGGACTGGGG + Exonic
1184959333 22:47917781-47917803 GAGAAGAGGGAGAGGGACTTAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
950065625 3:10109261-10109283 AAGCTGATGGAGAAAGACTGAGG + Intergenic
950164112 3:10780698-10780720 CATAAGCAGGAGAATGACTGGGG - Intergenic
950701996 3:14757316-14757338 CAGAAGGTGGTGAAGGTCTGTGG - Intronic
951205514 3:19922368-19922390 CATAGGATGAAGAAGAACTGGGG - Intronic
951399332 3:22212162-22212184 CAGAAGAGTGCAAAGGACTGAGG + Intronic
952586671 3:34901116-34901138 CAGCAGATGGAGGTGGCCTGGGG - Intergenic
952977195 3:38706616-38706638 CAGAAGACTGAGAAGAACTTAGG + Intronic
953749912 3:45601194-45601216 TGGAAGATGGAGAAGGAATCAGG + Intronic
954272111 3:49518069-49518091 AAGAAGCTGGTGAAGAACTGAGG + Intronic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955939089 3:64130940-64130962 CAAGAGATGGAGAAGGCCTGCGG + Intronic
955996985 3:64687894-64687916 CAGGAGGAGGAGGAGGACTGGGG + Exonic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956105889 3:65818527-65818549 CAGAAGATGCAGAGGGGCAGAGG + Intronic
956174208 3:66457928-66457950 CTGAAGATGAAGAGGAACTGAGG - Intronic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956954538 3:74321127-74321149 TACAAGAGGGAGGAGGACTGGGG + Intronic
956981886 3:74648555-74648577 GATAAGACAGAGAAGGACTGAGG - Intergenic
957191074 3:77010743-77010765 CAGAGGATAGAGACTGACTGAGG - Intronic
957500027 3:81043957-81043979 CAAGAGATGGAGCTGGACTGTGG - Intergenic
957852620 3:85829613-85829635 TAGAAGATGAACAAGGTCTGGGG - Intronic
958036386 3:88174503-88174525 CAGAAGACAGAGAATGACAGTGG + Intergenic
958460082 3:94383520-94383542 GAGAAGTTGGGGAAGGGCTGTGG - Intergenic
959009998 3:101064049-101064071 CTGGAGATTGTGAAGGACTGGGG - Intergenic
959839298 3:110955865-110955887 CAGAAGATTAAGAAGGATGGAGG - Intergenic
959897047 3:111617126-111617148 CAGCAGGTGGAGATGGGCTGAGG + Intronic
960735442 3:120774487-120774509 TAGAAGATAGAGAATGACTAGGG + Intronic
961597456 3:128029870-128029892 CAGAGGCTGGGGAAGGAATGGGG - Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
962281250 3:134053642-134053664 CAGAAGGTGGGGTAGGACTCGGG - Intergenic
962714061 3:138112013-138112035 AAAAAGATGGAGCAGAACTGTGG + Intronic
964809023 3:160642241-160642263 GAGAAGATGGGAAAGCACTGAGG + Intergenic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
967710191 3:192697677-192697699 ATGAAGATGGAGATGTACTGTGG + Intronic
968046239 3:195625113-195625135 GAGAAGAGGGACAAGGCCTGGGG + Intergenic
968308414 3:197664974-197664996 GAGAAGAGGGACAAGGCCTGGGG - Intergenic
968471335 4:783835-783857 CAGTGGATGGAAAATGACTGAGG - Intergenic
968601968 4:1513684-1513706 CAGAACATGGAGGGGGTCTGGGG + Intergenic
969842218 4:9891024-9891046 CTGAAGGAGGAGAAGGGCTGTGG - Intronic
970881761 4:20940865-20940887 AAGAAGGTAGAGAAAGACTGTGG + Intronic
971009619 4:22418862-22418884 CAGAAGAAGCAGGAGGGCTGAGG + Intronic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
975668473 4:76756353-76756375 AAGAGGGTGGAGAAAGACTGAGG - Intronic
976458607 4:85280857-85280879 CTGAAGTTGGACAAGCACTGGGG + Intergenic
976826617 4:89267628-89267650 CAGAAGCCAGAGATGGACTGGGG - Intronic
976971796 4:91112760-91112782 CTGAAGATGGAAGAGGACAGAGG - Intronic
977217875 4:94304268-94304290 AAGAAGAATGAGAAGGCCTGAGG - Intronic
977862156 4:101975049-101975071 CAAAAGAGAGAGAGGGACTGGGG + Intronic
978835420 4:113143719-113143741 TAGAACTTGGAGAAGGTCTGTGG - Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979021348 4:115502815-115502837 CAGAAGATGGAGATGGTAGGAGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
980447964 4:132936633-132936655 AAGAAGATTGAGAAGTACTAAGG - Intergenic
981196942 4:141932216-141932238 CAAAAAGTGGAGAAGGGCTGTGG + Intergenic
981370889 4:143957550-143957572 CCTAAGATCAAGAAGGACTGTGG + Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
985531121 5:434337-434359 ATCAAGATGGAGAAGGACTCTGG + Exonic
985747072 5:1653762-1653784 GAGAAGAGGGACAAGGCCTGGGG - Intergenic
986669152 5:10127546-10127568 CAGAAGAAGGAGATAGACTATGG + Intergenic
987080586 5:14421944-14421966 CAGGAGAAGGGGGAGGACTGTGG - Intronic
988622240 5:32834930-32834952 CACAAGATAGAGCAGTACTGAGG + Intergenic
988716115 5:33829874-33829896 CCTCAGATGGAAAAGGACTGGGG - Intronic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
989173762 5:38499909-38499931 CAGAAGATGCAGAGAGCCTGAGG - Intronic
990540109 5:56764124-56764146 CAGGAAATGGAGAAGAAATGTGG - Intergenic
992551757 5:77866253-77866275 CAGGAGACGGAGCAGGAGTGGGG + Intronic
992737950 5:79742627-79742649 CACATGATGGGGATGGACTGGGG - Intronic
993667847 5:90722848-90722870 CTGAAGATGGAGAAGGGAAGAGG + Intronic
994157111 5:96515874-96515896 CAGAAGATGTTGGAGGAATGAGG - Intergenic
995177553 5:109196266-109196288 GAGATGATGGAGTAGGAGTGGGG + Exonic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997409593 5:133680968-133680990 CACATGATGGAGAAGGACTCTGG - Intergenic
997527232 5:134561190-134561212 CACAAGGTGGAGAGGGTCTGAGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
998988419 5:147788363-147788385 GAAAGGATGAAGAAGGACTGAGG + Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
1000453334 5:161418257-161418279 CAGAAGAAGAATAATGACTGAGG - Intronic
1000614348 5:163411210-163411232 CAGAGGACGGAGAAGCAGTGTGG + Intergenic
1001107216 5:168864878-168864900 TAGAAAATGGATAAGGACGGTGG + Intronic
1001281344 5:170388555-170388577 GAGAAGATGGAGAAGGACAAAGG + Intronic
1001469427 5:171999712-171999734 CAGAAGAAAAAGAAAGACTGAGG - Intronic
1002806085 6:575452-575474 GAGAGGATGGAGAGGGAGTGAGG - Intronic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1003012737 6:2441204-2441226 GAGAAGATGGAGACTGTCTGAGG + Intergenic
1003692905 6:8372344-8372366 CAGATGATGGAGCAGGTCTCAGG - Intergenic
1005825589 6:29629919-29629941 CAGAAGATGAAGAACAACTCAGG - Intronic
1006032470 6:31187249-31187271 TAGAAGAGGGAGAAGGCCTAAGG + Intergenic
1006450526 6:34103370-34103392 CAGAAGCTGGAGAAGAATAGTGG + Intronic
1007159550 6:39777959-39777981 GAGAACATGGAGAAGGTCTCAGG - Intergenic
1007163677 6:39812763-39812785 CAGGAGCTGGAGGAGGACAGAGG - Intronic
1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG + Intergenic
1007258286 6:40543909-40543931 CAGAAGCCTGAGAAGGACTTGGG + Intronic
1007362398 6:41368355-41368377 TTAAAGATGGAGAAGAACTGAGG + Intergenic
1008309746 6:49952309-49952331 CAGCAGGTGGAGAAGGAATGTGG - Intergenic
1008561058 6:52725091-52725113 CTGATGATAGAGAAGGGCTGAGG - Intergenic
1008826699 6:55703138-55703160 CTGCAGATAGAGAAGGACTAGGG - Intergenic
1010928066 6:81767643-81767665 CAGGAGGTGGAGAAGAAATGTGG + Intergenic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1011837815 6:91456002-91456024 CAGTAGATGGAAAATTACTGAGG + Intergenic
1012253015 6:97000164-97000186 CAGAAGACTGAGGAGGACTCAGG + Intronic
1012472727 6:99589461-99589483 GAGAAGCTGGAGGAGGACCGGGG + Intergenic
1013317935 6:108959524-108959546 GACCAGGTGGAGAAGGACTGGGG + Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013588899 6:111603909-111603931 CAGCAGATTAAGAATGACTGTGG + Intronic
1013803693 6:113973703-113973725 CAGAAGGTAGAGAAGTACAGTGG + Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1014042114 6:116840320-116840342 GATAAGCTGGAGGAGGACTGGGG - Intergenic
1014344416 6:120250199-120250221 CAGAAGATGGACCAGGATTTAGG + Intergenic
1014854613 6:126384014-126384036 CAGCAAATGCAGAAGAACTGAGG + Intergenic
1015236516 6:130977582-130977604 CAGAAGTTGGAGCAGAGCTGGGG - Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017373186 6:153736563-153736585 CAGAATATGGAGATGAAATGGGG - Intergenic
1017442246 6:154475097-154475119 AAGCTGATGGAGAGGGACTGGGG + Intronic
1018630403 6:165817118-165817140 CAGGAGATGGAGAGGCACCGTGG - Intronic
1018633277 6:165838878-165838900 CAGAAAATGGACAAGGGCAGAGG - Intronic
1018909198 6:168092253-168092275 CTGGAGATGCACAAGGACTGTGG - Intergenic
1019018358 6:168896808-168896830 CTGGGGAGGGAGAAGGACTGGGG - Intergenic
1019258617 7:67333-67355 CAGCTCTTGGAGAAGGACTGAGG - Intergenic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1020120552 7:5500842-5500864 CAGAACACGGAGGAGGGCTGGGG + Exonic
1020883668 7:13795468-13795490 CAGATGATGGGGAAGGAAAGGGG - Intergenic
1021011705 7:15476453-15476475 CAGAACATGGATAAGGGCGGTGG + Intronic
1022465970 7:30653411-30653433 AAGAAGGTGGAGGAGGACAGGGG + Exonic
1023217792 7:37883643-37883665 CAGAAGATGGTGTAGGACAGAGG + Intronic
1023654496 7:42406401-42406423 CAGAAGATGGAGAAATGCAGAGG - Intergenic
1024004005 7:45212183-45212205 AAGAAAGGGGAGAAGGACTGGGG - Intergenic
1024323874 7:48093746-48093768 CATAGGAGGGAGAGGGACTGAGG - Intronic
1024982533 7:55169754-55169776 GAGAAGCTGGACAAGGACAGTGG - Intronic
1026157563 7:67840383-67840405 CAGATCTTGGAGAATGACTGTGG + Intergenic
1026497033 7:70912332-70912354 CAGAAGAAAGAGAAAGAATGAGG + Intergenic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027809641 7:82878910-82878932 CAGCAGATGGATAAAGCCTGTGG + Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028420601 7:90628473-90628495 CTGAAGTTTGAGAAGGACTGTGG - Intronic
1028463080 7:91118104-91118126 CAGAAGCTGGAGAAAGCATGCGG + Exonic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029888904 7:103905817-103905839 GAGAAGACGGAGAAGCACAGAGG + Intronic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1032108352 7:129054289-129054311 CGGAAGGTGGAGAAACACTGGGG + Intronic
1032455350 7:132069209-132069231 CAGAAGATGGTGTGGGACAGAGG - Intergenic
1032759242 7:134923445-134923467 CAGATGATTCAGAAGGAGTGTGG - Intronic
1033109529 7:138562096-138562118 CAGGAGATGGAGGAGGTCTTGGG + Intronic
1033142150 7:138837287-138837309 CAGAAGAAGGAGGAAGAATGCGG + Intronic
1034702574 7:153109226-153109248 CAGAAAATAGAGCAGGGCTGTGG + Intergenic
1034783506 7:153903885-153903907 CAGAAGCAGGAAGAGGACTGAGG + Intronic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035842991 8:2832479-2832501 CTGAAGATGGAGAGGGTTTGGGG + Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1037520297 8:19674519-19674541 CAGAGGAGGGAGAAGAACAGTGG + Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1040771238 8:50978655-50978677 CAGAAGCTGGAAAGGGTCTGGGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041342570 8:56861431-56861453 AAGAGGATGGAGAAGGACTATGG + Intergenic
1041448621 8:57982746-57982768 CATAAAATGCAGAAGGCCTGAGG - Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1042226310 8:66517482-66517504 CAGAACATAGAGAAGGACCAAGG + Exonic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043138146 8:76553732-76553754 CAGAAGAAGAAAAAGCACTGTGG + Intergenic
1046058545 8:109108259-109108281 CAAATGATGGAGAAGGAGAGAGG - Intronic
1046071071 8:109254094-109254116 AATAAGAAAGAGAAGGACTGTGG + Intronic
1047439168 8:124861249-124861271 CAGAAGATGGAGATGGCCACTGG + Intergenic
1048337980 8:133517186-133517208 CAGAATCCAGAGAAGGACTGGGG - Intronic
1048969879 8:139639517-139639539 CTGATGAAGGACAAGGACTGGGG + Intronic
1049853109 8:144844879-144844901 AAGAAGGTGGAGAGGGAGTGGGG + Intronic
1050568685 9:6914748-6914770 CAGAAGAGATAGAAGGAATGGGG - Intronic
1050984098 9:12060096-12060118 AAGAAGATGGAGAAGGTTGGGGG - Intergenic
1051109579 9:13620638-13620660 TAGCAGAGGGAGAAGGACAGAGG - Intergenic
1051667207 9:19476513-19476535 AAGAAGACTGAGATGGACTGTGG - Intergenic
1051735339 9:20192277-20192299 AAGAAGATGGACAAAGGCTGGGG + Intergenic
1051868404 9:21708436-21708458 TAGAGGATTAAGAAGGACTGGGG - Intergenic
1052469017 9:28869422-28869444 CAGAGGATGAACAAGGAGTGGGG + Intergenic
1052552262 9:29967266-29967288 CAGAAGAGGGAGAAGGGTTTTGG - Intergenic
1053284745 9:36842869-36842891 GAGATGAAGCAGAAGGACTGGGG - Intronic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053668287 9:40333358-40333380 CAGAATTTGGAGCAGGACAGAGG + Intergenic
1054379429 9:64473410-64473432 CAGAATTTGGAGCAGGACAGAGG + Intergenic
1054516325 9:66042935-66042957 CAGAATTTGGAGCAGGACAGAGG - Intergenic
1056052377 9:82782783-82782805 AACAAGATGGAGAAGGACTGGGG - Intergenic
1056759953 9:89407305-89407327 CAGCAGGAAGAGAAGGACTGAGG - Intronic
1056890474 9:90487413-90487435 GAGAAGATGGAGCAGCACTCTGG - Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058160876 9:101569392-101569414 CTGAAGATGGAAAAGACCTGAGG + Exonic
1058447512 9:105066871-105066893 TAGAAGATGGAGAAGCCGTGTGG + Intergenic
1058849927 9:109001664-109001686 CAAAAGATAGTGAAGAACTGAGG + Intronic
1059431956 9:114255626-114255648 CTGAAGAGGGGGAAGCACTGAGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059849403 9:118320586-118320608 CAGAAGAAGGAATTGGACTGAGG + Intergenic
1060252358 9:121996375-121996397 CTCAATATGGAGAAGGACTTTGG - Intronic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061083193 9:128384485-128384507 CAGAAGCTGGAAAGGGAATGAGG - Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1185499359 X:585182-585204 CAGAGGGTGGAGAGGGACTCAGG + Intergenic
1185708734 X:2285118-2285140 CAGAAGGTGGAGGTGGAATGTGG + Intronic
1185971206 X:4666638-4666660 CAGCAGATGGAGCAGAATTGAGG + Intergenic
1186526879 X:10257095-10257117 CAGAAGGTGGAAAAGGATTCAGG - Intergenic
1186923856 X:14310416-14310438 GAGATGAGGGAGAAGGCCTGTGG - Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1188023509 X:25184626-25184648 AAGGAGGTGGAGAGGGACTGAGG + Intergenic
1189474035 X:41335046-41335068 CAGAAGATTGGGGAGGAGTGGGG + Intronic
1190075024 X:47310716-47310738 CACAAGATGGAGGAGGGGTGTGG - Intergenic
1190554136 X:51616677-51616699 CCCTAGGTGGAGAAGGACTGGGG + Intergenic
1190601520 X:52097607-52097629 AAGATGGTGTAGAAGGACTGAGG + Intergenic
1192246601 X:69378252-69378274 CAGGTGTTGGAGAAGGACAGGGG + Intergenic
1192260652 X:69504422-69504444 CGGAAGATGGCGACAGACTGAGG + Intergenic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196883235 X:120219576-120219598 CAGAAGATGGGGGAGTGCTGAGG - Intergenic
1197467737 X:126825760-126825782 GAACAGATGGAGAAAGACTGAGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1198963052 X:142203096-142203118 CATAATATGGAGGAGAACTGTGG + Exonic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199810310 X:151342583-151342605 AAGAAGATGGAAAAGAAATGAGG + Intergenic
1200072562 X:153536386-153536408 CAGAAGATCGAGGAGGCCTACGG + Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200831397 Y:7690828-7690850 CAGAAGCTGGAGATGCCCTGTGG - Intergenic
1201063835 Y:10070447-10070469 CAGAAGCTGGAGATGCCCTGTGG - Intergenic