ID: 1165146519

View in Genome Browser
Species Human (GRCh38)
Location 19:33734591-33734613
Sequence ATGGCAGGGCGTTCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165146519_1165146527 3 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146527 19:33734617-33734639 TGTCCCAACTGCAGGAGCTCAGG 0: 1
1: 0
2: 4
3: 15
4: 199
1165146519_1165146525 -5 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146525 19:33734609-33734631 GCCATCGTTGTCCCAACTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1165146519_1165146534 21 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG 0: 1
1: 0
2: 22
3: 222
4: 1712
1165146519_1165146532 14 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146532 19:33734628-33734650 CAGGAGCTCAGGGAGAGGAGAGG 0: 1
1: 1
2: 10
3: 105
4: 1026
1165146519_1165146531 9 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146531 19:33734623-33734645 AACTGCAGGAGCTCAGGGAGAGG 0: 1
1: 0
2: 6
3: 52
4: 466
1165146519_1165146535 22 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG 0: 1
1: 6
2: 58
3: 567
4: 4182
1165146519_1165146528 4 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG 0: 1
1: 0
2: 2
3: 22
4: 200
1165146519_1165146533 18 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1165146533 19:33734632-33734654 AGCTCAGGGAGAGGAGAGGAAGG 0: 1
1: 1
2: 11
3: 116
4: 1007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165146519 Original CRISPR ATGGCAGGGCGTTCTCCTGG GGG (reversed) Intronic
912211134 1:107558280-107558302 AAGGCAGGGTGTTCATCTGGTGG - Intergenic
916717995 1:167461164-167461186 ATGGGAGGGAGTTCACCTTGCGG + Intronic
916898942 1:169200217-169200239 ATGGCAGGGAGTTATTCTGTTGG + Intronic
920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG + Intronic
921639035 1:217529387-217529409 ATGGTAGTGAGTTCTCCTGCTGG + Intronic
922295988 1:224250231-224250253 ATGGCAAGGCGATCTGCAGGGGG + Exonic
924106512 1:240654501-240654523 CCAGCAGGGAGTTCTCCTGGAGG - Intergenic
1063380660 10:5583551-5583573 ATGGCAGGGCGCTGTGCTGGGGG + Intergenic
1065167399 10:22994194-22994216 AGGGCTGGGCATTGTCCTGGGGG + Intronic
1067358043 10:45549425-45549447 AAGGCAGGGCCTTCTCCATGTGG + Intronic
1067411517 10:46068923-46068945 CTGGCAGGGTTTTCTGCTGGGGG + Intergenic
1068386881 10:56341360-56341382 ATCTCTGGGCGTTTTCCTGGAGG - Intergenic
1068584995 10:58788090-58788112 AGGGCAGGATGATCTCCTGGGGG + Intronic
1070731520 10:78831774-78831796 ATGGCAAGGGATTCTCCCGGGGG - Intergenic
1073465898 10:103694299-103694321 GTGGAAGGGGGTTCTCTTGGAGG + Intronic
1075426285 10:122344060-122344082 ATAGAAGGAGGTTCTCCTGGAGG + Intergenic
1076208269 10:128620568-128620590 AGGGCAGGGAGCTCTCTTGGGGG - Intergenic
1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1079366449 11:19814268-19814290 ATGCCAGGGAGTACTCCTGAGGG + Intronic
1080898647 11:36467043-36467065 ATGGCTGGCCTTTCTCCTGCTGG - Intergenic
1083254701 11:61488989-61489011 AGGGGAGGGCGGTGTCCTGGAGG + Intronic
1084399850 11:68937176-68937198 AAGGAAGGGCTTCCTCCTGGTGG + Intronic
1086056177 11:82649743-82649765 AAGGCAGGGCTTTCTTCTTGAGG + Intergenic
1091232481 11:133997789-133997811 AGGGCAGGATGTTGTCCTGGCGG - Intergenic
1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1101747408 12:107553615-107553637 GTGGCAGGACGTTCTCCTGTAGG + Intronic
1102285815 12:111655505-111655527 ATGGCAGGGCACTCTGATGGGGG - Intronic
1102994671 12:117339516-117339538 ATGTCAGGACTTTCTCCTGCAGG + Intronic
1103877502 12:124140010-124140032 AGGGCAGGGTGTTCACCTGAAGG - Intronic
1104757749 12:131279490-131279512 ATGGCCAGGCTTTCTCCTGCTGG + Intergenic
1105344806 13:19561888-19561910 AGGGCAGGGCGGGCTCCAGGCGG - Intergenic
1106554948 13:30801546-30801568 ATGGTAGGCCTTTCTCCTGCAGG + Intergenic
1108912655 13:55576680-55576702 ATGCCAGGGAATTCTACTGGGGG - Intergenic
1111495512 13:89044029-89044051 ATGGGATGGCGTTCTGCTAGGGG + Intergenic
1113461303 13:110484448-110484470 ATGGAAGGGAGGTCTCCGGGGGG - Intronic
1113607484 13:111620726-111620748 GCGGCAGGGCCCTCTCCTGGGGG + Intronic
1114611443 14:24044019-24044041 ATGGCTTGGTGCTCTCCTGGTGG - Intergenic
1117097680 14:52314606-52314628 ATGGCTGGGCTTTCGCCTGGGGG - Exonic
1118974668 14:70666311-70666333 ATGGCAGGCAGGTCTCATGGTGG - Intronic
1119386961 14:74263428-74263450 AAGGAAGGGAGTTCTCTTGGGGG - Intergenic
1119590514 14:75883097-75883119 ATGGCAGGGCTTTACCCTGTGGG + Intronic
1120000451 14:79297112-79297134 ATGGCAGGGGGATTTCCTTGAGG - Intronic
1120000590 14:79298797-79298819 ATGGCAGGGGGATTTCCTTGAGG + Intronic
1124086002 15:26551325-26551347 ATTGCAGGGCGCTCTCCCTGGGG - Intronic
1127859691 15:62982996-62983018 AGGGGAGGGCATTCTGCTGGGGG + Intergenic
1131595084 15:93790169-93790191 ATGGCTGGGTTTTCCCCTGGGGG + Intergenic
1135355071 16:21762226-21762248 TTGTCAGGGCGTTTCCCTGGTGG + Intergenic
1135453555 16:22578368-22578390 TTGTCAGGGCGTTTCCCTGGTGG + Intergenic
1135521575 16:23182492-23182514 ATGGCAGGGCGGCCTCGGGGCGG + Intergenic
1135620379 16:23950388-23950410 CAGGCAGGGCTTCCTCCTGGAGG + Intronic
1137476053 16:48811015-48811037 ATGGCAGAGGCTTTTCCTGGCGG - Intergenic
1141176972 16:81727193-81727215 AAGGCAGGGCCCTCTCCTGATGG - Intergenic
1141278685 16:82610695-82610717 GTGGCAGGGCCTTCTCCTCTGGG + Intergenic
1141672377 16:85499031-85499053 AAGGCAGGGCTTTTTCCAGGAGG + Intergenic
1141967138 16:87453141-87453163 AAGGAAGGGGGTGCTCCTGGGGG + Intronic
1143709504 17:8724630-8724652 ATGGCTGGGCCGTCACCTGGAGG - Intergenic
1144173255 17:12680561-12680583 ATGGCAGGTCCTTTTCCCGGAGG + Intronic
1148139166 17:45316550-45316572 ATGCCAGGGCGCACTCCTGCAGG + Intronic
1148160184 17:45445215-45445237 AGGGCAAGGCGTCCACCTGGAGG - Intronic
1149100267 17:52897694-52897716 AGGTCAGGGCCTTCTCCTGAAGG + Intronic
1149656238 17:58310894-58310916 CTTGCAGGGGGTGCTCCTGGAGG + Exonic
1152214795 17:79025702-79025724 ATGGGAGGACGTGCTCCAGGAGG + Intronic
1152575120 17:81136530-81136552 ATGGGATGGCGTCCTGCTGGGGG - Intronic
1152696622 17:81800829-81800851 ATTGCAGGGGGCCCTCCTGGAGG - Intergenic
1153844172 18:9033450-9033472 ATGGTAGTGGGGTCTCCTGGGGG + Intergenic
1154321451 18:13356726-13356748 AAGACAGGGGGTGCTCCTGGAGG - Intronic
1154330682 18:13426754-13426776 ATGGCAGGATGTTCTACTGCAGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160373672 18:78394866-78394888 CTGGCCGGCTGTTCTCCTGGAGG - Intergenic
1160838457 19:1135763-1135785 ATGGGAGGGGCTCCTCCTGGAGG + Intronic
1165146519 19:33734591-33734613 ATGGCAGGGCGTTCTCCTGGGGG - Intronic
1166282169 19:41801326-41801348 GTGGAAGCTCGTTCTCCTGGTGG - Intronic
927251251 2:20996686-20996708 AAGGCAGGGCCCTCTCCTTGTGG + Intergenic
927954700 2:27200435-27200457 ATCACAGGGAGGTCTCCTGGAGG + Exonic
930762531 2:55050898-55050920 CCGGAAGGGCGTTATCCTGGGGG + Intronic
945270253 2:207931038-207931060 ACAGCATGGCGTTCTCCTGCTGG + Exonic
947579873 2:231308444-231308466 ATGGCAGAGGGTGCTCCTGGAGG + Intronic
947623474 2:231605044-231605066 AAGGCCGGGCGTCCTCCTGGAGG - Intergenic
1169870013 20:10240023-10240045 ATGGCAGGGCTCTCTCCTTAGGG + Intronic
1175126101 20:56752564-56752586 ATGGCACCGCCTTATCCTGGAGG + Intergenic
1176170832 20:63695713-63695735 AGGGCAGGCCCTTGTCCTGGTGG + Intronic
1178760222 21:35395054-35395076 ATGGCAGGGCTGTCTGCTGGTGG - Intronic
1180008598 21:45034900-45034922 ATGTCAGGGCTGTCTCCTGTGGG - Intergenic
1181314467 22:21962561-21962583 CTGGCAGAGCGTGCCCCTGGAGG - Exonic
1182622336 22:31624978-31625000 ATGGCAGTGTGGTCTCCTGCTGG - Intronic
1183356252 22:37361393-37361415 CTGGCAGGAACTTCTCCTGGGGG - Intergenic
1185009603 22:48305783-48305805 ATTGCAGGGCTCTCTGCTGGAGG - Intergenic
950586760 3:13897837-13897859 ATGGCACCCCTTTCTCCTGGTGG + Intergenic
950723967 3:14903957-14903979 ATGGCAGGACGCCCTTCTGGTGG + Intronic
952831789 3:37571188-37571210 AGGGCAGGGAGATCTACTGGAGG + Intronic
953248961 3:41225736-41225758 ATGGCAGTGCGTTTAGCTGGTGG + Exonic
954683499 3:52358439-52358461 AAGGCAGGGCTTTCTTCTTGAGG + Intronic
954812812 3:53258264-53258286 ATGGCAGGATCTTCTCCTGCCGG + Intergenic
960359409 3:116693115-116693137 ATGGCAGGGAGTTCTGATGGAGG + Intronic
962498644 3:135966515-135966537 GCGGAGGGGCGTTCTCCTGGGGG + Intronic
963071446 3:141308508-141308530 AGGGCAAGTCCTTCTCCTGGTGG + Intergenic
963091344 3:141486772-141486794 GGGCCGGGGCGTTCTCCTGGTGG + Intergenic
968818346 4:2833156-2833178 AGGGGAGGGCGGTATCCTGGAGG - Intronic
970213295 4:13732945-13732967 TTGGCAGGGCATGCCCCTGGGGG + Intergenic
970585448 4:17510667-17510689 AAGGCTGTGCTTTCTCCTGGTGG - Intronic
976411678 4:84720547-84720569 ATGGCTTGGTGTTGTCCTGGCGG + Intronic
981739103 4:147984333-147984355 TTGGCAGTGCGTCCTCCTGCTGG - Intronic
982206536 4:153001180-153001202 ATGGCAGAGAGAGCTCCTGGGGG - Intergenic
982657407 4:158167438-158167460 CAGGCTGGGCTTTCTCCTGGAGG - Intronic
988683445 5:33504732-33504754 ATTGCAGGGAGTCCTCTTGGAGG - Intergenic
994465630 5:100125976-100125998 TTGGAAGGGAGTTCCCCTGGAGG + Intergenic
995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG + Intergenic
997283359 5:132662190-132662212 GTGGCAGGGAGTTCGCCAGGGGG + Intergenic
999595214 5:153195754-153195776 ATAGCAGGGTGTTTTTCTGGAGG - Intergenic
1001021717 5:168188762-168188784 ATTCCAGGGCCTGCTCCTGGAGG + Intronic
1001810058 5:174620647-174620669 ATGGGAGGAAGTGCTCCTGGAGG - Intergenic
1005130232 6:22498468-22498490 ACAGCAGGGCCTCCTCCTGGTGG - Intergenic
1006410791 6:33872192-33872214 AAGGCAGGGCCATGTCCTGGTGG - Intergenic
1008466622 6:51838443-51838465 TTGGTAGGGAGTTCTCCTGGAGG - Intronic
1013110635 6:107062036-107062058 ATTGCAGGGCTTCCTCATGGAGG + Intergenic
1017486829 6:154910465-154910487 ATAGCGGGGCTTTCTCTTGGAGG + Intronic
1019014768 6:168871869-168871891 CTGGCTGGGTGTTCTCCTGGGGG - Intergenic
1019591654 7:1838809-1838831 ATGGCAGGACGTTCACCCCGTGG - Exonic
1019931465 7:4226159-4226181 CTGGCAAGACGTTCTCCAGGTGG + Intronic
1022818665 7:33937576-33937598 AAGGAAGGGGGCTCTCCTGGAGG + Intronic
1022902206 7:34822089-34822111 AGGCCAGGGAGTTCTCCCGGGGG - Intronic
1025155028 7:56597402-56597424 AGGGGACGGCGTTCTCGTGGAGG - Intergenic
1026399747 7:69997719-69997741 ATGGCTTGGTGTTCTCCAGGGGG - Intronic
1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG + Intronic
1028699442 7:93760353-93760375 AAGGCATGGCGTTTTACTGGGGG - Intronic
1029588612 7:101492058-101492080 AGGGCAGGGTGCTCACCTGGAGG + Intronic
1049656766 8:143802519-143802541 ATGCCTGGGCCTTCACCTGGAGG - Intronic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1057842816 9:98500258-98500280 ATGGCAGGGGGTGCCCCTGGGGG + Intronic
1059463663 9:114451641-114451663 AGGGCAGGGCCTTCCCCTGTAGG - Intronic
1059708161 9:116842870-116842892 CTGCCAGGGAGCTCTCCTGGGGG - Intronic
1062371078 9:136239052-136239074 CTGGCAGGGCCTTCACCTCGTGG + Intronic
1186870170 X:13763774-13763796 ATGGGCGGGCTTTCTCCTGCCGG + Exonic
1199299619 X:146197706-146197728 AGGCCAAGGTGTTCTCCTGGTGG + Intergenic