ID: 1165146519

View in Genome Browser
Species Human (GRCh38)
Location 19:33734591-33734613
Sequence ATGGCAGGGCGTTCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165146519_1165146528 4 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146519_1165146532 14 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146532 19:33734628-33734650 CAGGAGCTCAGGGAGAGGAGAGG No data
1165146519_1165146534 21 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146519_1165146531 9 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146531 19:33734623-33734645 AACTGCAGGAGCTCAGGGAGAGG No data
1165146519_1165146535 22 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG No data
1165146519_1165146525 -5 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146525 19:33734609-33734631 GCCATCGTTGTCCCAACTGCAGG No data
1165146519_1165146533 18 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146533 19:33734632-33734654 AGCTCAGGGAGAGGAGAGGAAGG No data
1165146519_1165146527 3 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146527 19:33734617-33734639 TGTCCCAACTGCAGGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165146519 Original CRISPR ATGGCAGGGCGTTCTCCTGG GGG (reversed) Intronic