ID: 1165146528

View in Genome Browser
Species Human (GRCh38)
Location 19:33734618-33734640
Sequence GTCCCAACTGCAGGAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165146517_1165146528 9 Left 1165146517 19:33734586-33734608 CCCAGCCCCCAGGAGAACGCCCT No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146514_1165146528 15 Left 1165146514 19:33734580-33734602 CCAGCCCCCAGCCCCCAGGAGAA No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146518_1165146528 8 Left 1165146518 19:33734587-33734609 CCAGCCCCCAGGAGAACGCCCTG No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146516_1165146528 10 Left 1165146516 19:33734585-33734607 CCCCAGCCCCCAGGAGAACGCCC No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146515_1165146528 11 Left 1165146515 19:33734584-33734606 CCCCCAGCCCCCAGGAGAACGCC No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146520_1165146528 3 Left 1165146520 19:33734592-33734614 CCCCAGGAGAACGCCCTGCCATC No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146522_1165146528 1 Left 1165146522 19:33734594-33734616 CCAGGAGAACGCCCTGCCATCGT No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146523_1165146528 -10 Left 1165146523 19:33734605-33734627 CCCTGCCATCGTTGTCCCAACTG No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146519_1165146528 4 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data
1165146521_1165146528 2 Left 1165146521 19:33734593-33734615 CCCAGGAGAACGCCCTGCCATCG No data
Right 1165146528 19:33734618-33734640 GTCCCAACTGCAGGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165146528 Original CRISPR GTCCCAACTGCAGGAGCTCA GGG Intronic