ID: 1165146534

View in Genome Browser
Species Human (GRCh38)
Location 19:33734635-33734657
Sequence TCAGGGAGAGGAGAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165146522_1165146534 18 Left 1165146522 19:33734594-33734616 CCAGGAGAACGCCCTGCCATCGT No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146520_1165146534 20 Left 1165146520 19:33734592-33734614 CCCCAGGAGAACGCCCTGCCATC No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146516_1165146534 27 Left 1165146516 19:33734585-33734607 CCCCAGCCCCCAGGAGAACGCCC No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146519_1165146534 21 Left 1165146519 19:33734591-33734613 CCCCCAGGAGAACGCCCTGCCAT No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146524_1165146534 6 Left 1165146524 19:33734606-33734628 CCTGCCATCGTTGTCCCAACTGC No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146523_1165146534 7 Left 1165146523 19:33734605-33734627 CCCTGCCATCGTTGTCCCAACTG No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146515_1165146534 28 Left 1165146515 19:33734584-33734606 CCCCCAGCCCCCAGGAGAACGCC No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146521_1165146534 19 Left 1165146521 19:33734593-33734615 CCCAGGAGAACGCCCTGCCATCG No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146517_1165146534 26 Left 1165146517 19:33734586-33734608 CCCAGCCCCCAGGAGAACGCCCT No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146526_1165146534 2 Left 1165146526 19:33734610-33734632 CCATCGTTGTCCCAACTGCAGGA No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146530_1165146534 -9 Left 1165146530 19:33734621-33734643 CCAACTGCAGGAGCTCAGGGAGA No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146518_1165146534 25 Left 1165146518 19:33734587-33734609 CCAGCCCCCAGGAGAACGCCCTG No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data
1165146529_1165146534 -8 Left 1165146529 19:33734620-33734642 CCCAACTGCAGGAGCTCAGGGAG No data
Right 1165146534 19:33734635-33734657 TCAGGGAGAGGAGAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165146534 Original CRISPR TCAGGGAGAGGAGAGGAAGG AGG Intronic