ID: 1165147039

View in Genome Browser
Species Human (GRCh38)
Location 19:33737466-33737488
Sequence CTGTGGCCATAATTAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165147035_1165147039 3 Left 1165147035 19:33737440-33737462 CCTTGGTGACCAGGGCTAAGCGT 0: 1
1: 0
2: 1
3: 5
4: 98
Right 1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 154
1165147031_1165147039 24 Left 1165147031 19:33737419-33737441 CCTAGCACTGGGTATTGGCTGCC 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 154
1165147036_1165147039 -6 Left 1165147036 19:33737449-33737471 CCAGGGCTAAGCGTTCACTGTGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 154
1165147030_1165147039 25 Left 1165147030 19:33737418-33737440 CCCTAGCACTGGGTATTGGCTGC 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165147039 Original CRISPR CTGTGGCCATAATTAGAGCT GGG Intronic
902229650 1:15019862-15019884 CTGTTGTCATTATTAGTGCTGGG + Intronic
902425090 1:16314367-16314389 CTGTAGCCTTAATAAGAGCATGG + Intronic
903959608 1:27048402-27048424 GTGTGGCCATATTGAGAGGTAGG - Intergenic
904803996 1:33118268-33118290 CTGTGGCCATAAGTGAGGCTGGG + Intronic
905328778 1:37177283-37177305 CTGTCGCCATAGTTTGGGCTTGG + Intergenic
909212833 1:72845983-72846005 CTGTGGCCATAAAGAGATCTAGG - Intergenic
910901895 1:92130262-92130284 GTGTGGTCATATTTAGAGATGGG - Intronic
912905221 1:113698883-113698905 TGGTGGCCATAGCTAGAGCTTGG + Intronic
919931323 1:202223143-202223165 CTGTGGCCATAGTTTCAGGTGGG - Intronic
922722846 1:227907478-227907500 CTGTGGCCATAAAAAGAGCAGGG - Intergenic
923459748 1:234197969-234197991 CTCTGGTCATAATTAGCACTTGG + Intronic
923742753 1:236670828-236670850 CAGTAGTGATAATTAGAGCTGGG + Intergenic
924145498 1:241070573-241070595 TTGAGGCCTTGATTAGAGCTGGG + Intronic
924753419 1:246919389-246919411 GTGTGGCCAGAATTCAAGCTAGG + Intronic
1068788552 10:61002252-61002274 AGGTGGCCACACTTAGAGCTTGG - Intergenic
1071218810 10:83439486-83439508 CAATGGCCATGATTAGAGATTGG - Intergenic
1071413011 10:85415147-85415169 ATGTGGCTATATTTAGAGATGGG - Intergenic
1073214156 10:101827401-101827423 CTGTGGCCATGATGTGAGCGAGG + Intronic
1073481924 10:103791491-103791513 CTGTGGACATCAAGAGAGCTGGG - Intronic
1076041954 10:127257686-127257708 CTGTGCCCATGATGACAGCTAGG - Intronic
1077042666 11:531442-531464 CTGTGGCCAGACCTAGAACTTGG + Intergenic
1077465249 11:2730866-2730888 CTGTGGCCAGAAGCAGGGCTGGG + Intronic
1079703257 11:23576662-23576684 CTGCGAACATAATTACAGCTAGG + Intergenic
1083802700 11:65055864-65055886 AGGTGTCCATAATAAGAGCTGGG - Intronic
1088816415 11:113423977-113423999 CTGAGGCCAGAATTCCAGCTTGG + Intronic
1090403908 11:126466091-126466113 CAGAGGGCCTAATTAGAGCTGGG - Intronic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1095142711 12:38686365-38686387 CTGTCCCCAGAATAAGAGCTTGG - Intronic
1095665654 12:44794582-44794604 GTGATGCCAGAATTAGAGCTAGG - Intronic
1095745449 12:45653387-45653409 CTGTACTCATAATTAGACCTGGG - Intergenic
1098856042 12:75654329-75654351 CTGGAGGGATAATTAGAGCTTGG + Intergenic
1099695854 12:86018173-86018195 CTGTGGCCCTAAGTAGAGGTGGG + Intronic
1100143560 12:91649358-91649380 CTGTGGGACTAATTAGAGCTGGG - Intergenic
1100794162 12:98162967-98162989 CTGTGGCCATAATCACAGCTGGG + Intergenic
1106050835 13:26187889-26187911 CTGTGGTCTCAAATAGAGCTAGG - Intronic
1106483763 13:30155499-30155521 CCGTGGCCCAAATGAGAGCTTGG + Intergenic
1107750307 13:43558091-43558113 CTGTGGTCATTCTGAGAGCTGGG + Intronic
1110720943 13:78760862-78760884 CATTGGCCAGACTTAGAGCTTGG + Intergenic
1115012674 14:28568844-28568866 CTGATTCCATAATTTGAGCTGGG + Intergenic
1115246841 14:31304330-31304352 CAGTGGCAATTATTAGTGCTTGG - Intronic
1116788352 14:49312539-49312561 CTGTGGCCAAGATCAGAGGTGGG - Intergenic
1118489046 14:66241545-66241567 CTGTGGCAATATTAAGAGATGGG + Intergenic
1118841784 14:69518944-69518966 CTGTCACCAAAATAAGAGCTAGG - Intronic
1119511447 14:75214811-75214833 CTTTGGCCTTAACTAGAGCATGG - Intergenic
1119536482 14:75406928-75406950 ATGTGGCCATATTGAGAGGTGGG - Intergenic
1121847877 14:97189898-97189920 CCGTGGCCAGAATTTGAGCTGGG + Intergenic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1127180077 15:56406111-56406133 CTGGTGCCATAGTTAGAGGTTGG - Intronic
1128398324 15:67251832-67251854 CTTTGACTATAATTAAAGCTGGG - Intronic
1128599442 15:68983332-68983354 CTGTGGCTGACATTAGAGCTGGG + Intronic
1128802260 15:70504360-70504382 CTGGGGCCATAAGTAGACCCAGG - Intergenic
1129295894 15:74599939-74599961 CTGTGGCTAAGAGTAGAGCTAGG - Intronic
1129369198 15:75077736-75077758 CAGTGGCCAGAATCAGAACTGGG - Intronic
1129375020 15:75124466-75124488 CAGTGGCCAGAATCAGAACTGGG + Intergenic
1130080439 15:80728125-80728147 CTGTTGCCAGGATTAGAGATAGG + Intronic
1131802825 15:96089547-96089569 CTGAGGCCAGAAATAGAGCTTGG + Intergenic
1133165911 16:3947085-3947107 CGGTGGCCACAGTTAGAGGTGGG - Intergenic
1137482585 16:48864929-48864951 CTGTGCCCATCAGAAGAGCTGGG + Intergenic
1138323680 16:56142240-56142262 TTGTGGCCATATTGAGAGGTGGG - Intergenic
1143500052 17:7333608-7333630 CTGTGACCATGGTGAGAGCTTGG - Intergenic
1143540204 17:7563864-7563886 CTGTTGCCATGGTGAGAGCTGGG + Intronic
1148091320 17:45024064-45024086 CTGTGGCCCTCCTCAGAGCTGGG - Exonic
1149988531 17:61366992-61367014 CTGTGGCCATTATCAGAGGCAGG + Intronic
1151508888 17:74546316-74546338 CTGAGGCCAGAAGAAGAGCTGGG - Intergenic
1152976717 18:228180-228202 CTGTGGCCACAGCTAGACCTGGG + Intronic
1156525130 18:37759823-37759845 CTGTGGCCAGCTTTAGAGATTGG - Intergenic
1159856775 18:73598340-73598362 GTGTGGCCATAAGTGGGGCTTGG + Intergenic
1160807741 19:1000161-1000183 CTGTGGCCTGAATCAGAGCAGGG + Intergenic
1164874429 19:31673342-31673364 ACGTGGTCATAATCAGAGCTGGG + Intergenic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
926887744 2:17613416-17613438 CTGTGGCCATAATTTGAATTTGG - Intronic
927431872 2:23033351-23033373 CTGTGGCAGTAATAAGAGGTGGG - Intergenic
928625239 2:33133191-33133213 CTGTGGTCATAAGCTGAGCTTGG - Intronic
932022167 2:68098559-68098581 CTATGGCTATAATTAGTTCTTGG + Intronic
932105561 2:68938004-68938026 CTGTGGCCAGCATTAGGGATAGG - Intergenic
932774414 2:74518975-74518997 CTGGGGCCAAAATTATGGCTGGG - Intronic
934951066 2:98576056-98576078 GTGTGGCAATAATATGAGCTTGG - Intronic
935580520 2:104752366-104752388 CTGTGGCCTTCCTTAGCGCTGGG - Intergenic
937780677 2:125833605-125833627 ATGTGGCCTTAATTAGAAATAGG + Intergenic
937949482 2:127372676-127372698 CTGTGGCCATTATTAGAAAGAGG - Intronic
940035616 2:149309687-149309709 CCATGGCCATGGTTAGAGCTTGG - Intergenic
942931884 2:181503630-181503652 TGGTGGCCAAAATTAAAGCTTGG - Intronic
943296189 2:186142805-186142827 ATGTGGCTATATTTGGAGCTAGG + Intergenic
944915322 2:204354545-204354567 CTGTGGCCATAAACAGAGCAGGG - Intergenic
945393567 2:209294913-209294935 ATGTGGCCATATTGAGAGGTGGG - Intergenic
946266817 2:218551555-218551577 CTTTGGCCATAAATAGATGTAGG - Intronic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948294215 2:236848542-236848564 CTGGGGACATGATTAGAGCAGGG + Intergenic
1170597960 20:17819654-17819676 ATGTGGCTATATTTAGAGGTAGG - Intergenic
1175446198 20:59021562-59021584 CTGTTTCCATATTAAGAGCTTGG + Intronic
1177246803 21:18536169-18536191 CTGGGGCCATGATCAGAGGTTGG - Intergenic
1182009281 22:26986761-26986783 CTGGGGCCAGAAACAGAGCTGGG - Intergenic
950104096 3:10377425-10377447 TGGTGTCTATAATTAGAGCTGGG + Intronic
951861039 3:27252876-27252898 TTGTGGCCATACTGAGGGCTTGG + Intronic
952581560 3:34839078-34839100 CTGTGACCTTATTTAGAACTAGG - Intergenic
953058951 3:39411053-39411075 CTGTGCACATTGTTAGAGCTTGG + Intronic
953198596 3:40756363-40756385 ATGTGACCATATTTGGAGCTAGG + Intergenic
954449748 3:50565454-50565476 CTGTGGCCTTGGTGAGAGCTGGG - Exonic
954576052 3:51676930-51676952 CTGTGTCCCCATTTAGAGCTAGG + Intronic
955132083 3:56180103-56180125 CTGTGTCCATAATGAGAGCGTGG + Intronic
955990181 3:64618449-64618471 CTGAAGCCCTAATTACAGCTAGG + Intronic
956849549 3:73216452-73216474 CTGTGGCCAGTAATAGAGCTGGG + Intergenic
956982363 3:74653857-74653879 ATGTTGCCATAATAAGAGATAGG + Intergenic
959805936 3:110553774-110553796 CTGTGGCCAAGATTGGAGCGGGG - Intergenic
961437137 3:126927147-126927169 CTGTGGCCAAAAGGAGAGCTGGG + Intronic
962978164 3:140464176-140464198 CTCTGACCATGTTTAGAGCTAGG + Intronic
963765292 3:149328394-149328416 CTGTGGCGATATTAAGAGGTGGG - Intronic
966294960 3:178408876-178408898 CTGTGGCAATAATGAGAGAAAGG + Intergenic
967498810 3:190173857-190173879 CTGTGGAAATAATTAGATTTTGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
972790548 4:42367620-42367642 CTGTGGGGATAGTGAGAGCTTGG + Intergenic
973576860 4:52298313-52298335 CTGTAGCCATAAGCAGAGCAGGG + Intergenic
976425752 4:84901267-84901289 ATGTGGCAGTAATTAGAGGTGGG + Intronic
977821410 4:101476334-101476356 CTTTCTCCATAATAAGAGCTAGG - Intronic
979669742 4:123349599-123349621 CTGTGGCCATAAAAAGAGTAAGG - Intergenic
980610909 4:135162335-135162357 ATGTGGCCTTATTTAGAGATAGG + Intergenic
983643874 4:169970079-169970101 CTGTGGCTCTAATTTGAGATGGG - Intergenic
988351871 5:30118945-30118967 CAGTGGCTAAAATTAGAGCTAGG - Intergenic
990461841 5:56037914-56037936 CTGTGGCCAAGATCAGACCTTGG + Intergenic
990746956 5:58968207-58968229 CTGTGGCAGTAATGAGAGATGGG + Intergenic
994330679 5:98502188-98502210 CTGTGGCTAAAATCAGAGGTTGG + Intergenic
995614004 5:113940929-113940951 CTGTGGCCATGATTTTAGCCTGG - Intergenic
999855426 5:155588078-155588100 CTGTGGCTCTAATTTGAGCAAGG + Intergenic
1000272190 5:159696721-159696743 CTGGGGACATAATGAGAGATGGG + Intergenic
1004358531 6:14950779-14950801 ATGTGGCTATATTTGGAGCTAGG + Intergenic
1007538304 6:42616135-42616157 CTATGCCCATAATTATATCTAGG + Intronic
1010553196 6:77248510-77248532 GTGTGGACATAATGAGAGATGGG + Intergenic
1011256099 6:85422653-85422675 CTGAGGACCTAATTACAGCTGGG - Intergenic
1012698690 6:102423387-102423409 CTCTGCCCATAAGTAGACCTTGG - Intergenic
1017637990 6:156462009-156462031 ATTTGGCCTTAATTAGAGCATGG - Intergenic
1018522014 6:164659777-164659799 CTGTGGACATAACTAAAGCTAGG + Intergenic
1018576667 6:165266769-165266791 CTGTGGGTGTAATTGGAGCTGGG + Intergenic
1020891574 7:13884830-13884852 ATGTGACCTTATTTAGAGCTAGG + Intergenic
1024645026 7:51363684-51363706 CTGTGGCCATACTGGGATCTAGG - Intergenic
1024819423 7:53310173-53310195 CTGTGGACATAATTTGGGGTAGG + Intergenic
1026428714 7:70322854-70322876 CTCTGGACATAAGTGGAGCTGGG - Intronic
1030081843 7:105785053-105785075 CTGTGCCCAAAATCAGACCTCGG + Intronic
1034104286 7:148477198-148477220 CTGTGACTATATTTAGAGATGGG + Intergenic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1036109121 8:5878336-5878358 CTGTGGCCATTATCAGAAATAGG + Intergenic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1037932326 8:22888905-22888927 CTGTGGCCAGGATTAGCCCTGGG - Intronic
1039388505 8:37158145-37158167 CTGGGCTCATAATTGGAGCTGGG + Intergenic
1039622393 8:39010307-39010329 CTGTGGCAATAGAAAGAGCTTGG + Intronic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1041593224 8:59616037-59616059 CTGTGACCAAAATTAGAGCAAGG - Intergenic
1046344120 8:112900546-112900568 CTGTGGCTATCTTTAGTGCTGGG + Intronic
1048320934 8:133399760-133399782 CTGTGGCCAGACACAGAGCTGGG + Intergenic
1048422722 8:134293338-134293360 TTGTGGCCATATTTGGAGATGGG + Intergenic
1050312969 9:4371954-4371976 CTCTGGCCATAATTGCACCTGGG + Intergenic
1052028632 9:23603400-23603422 CTCTGGCCACATTTCGAGCTCGG + Intergenic
1054837852 9:69698868-69698890 ATGTGGCCATACTGAGAGGTGGG + Intergenic
1055332215 9:75196438-75196460 ATGTGGCTATATTTGGAGCTAGG - Intergenic
1056423276 9:86451211-86451233 GTGTGGCCATCTTTGGAGCTAGG + Intergenic
1056425348 9:86470010-86470032 CTGTGGCCATAAAAAGAGAAGGG - Intergenic
1059638513 9:116193306-116193328 CAGTGGCCCTGATTAGAGCAGGG - Intronic
1061131766 9:128712549-128712571 CTGTGGCAAGGATAAGAGCTTGG - Intronic
1061750686 9:132774897-132774919 CTGGGCCCCTAATAAGAGCTTGG + Intronic
1203791695 EBV:155062-155084 CTCTGGGCAAAATTAGGGCTGGG - Intergenic
1187019403 X:15364668-15364690 CTGAGGCCATTTGTAGAGCTGGG + Intronic
1188458804 X:30398276-30398298 TTGTGGCAATCATAAGAGCTAGG - Intergenic
1189286975 X:39858599-39858621 ATGTGGCTATATTTAGAGTTAGG - Intergenic
1190457009 X:50636344-50636366 CTGTGCCAGTAGTTAGAGCTGGG - Intronic
1192801277 X:74466939-74466961 CTGTGGCCATAAAATGATCTGGG - Intronic
1194232802 X:91345232-91345254 CTTTGGCCAAAATTTAAGCTAGG - Intergenic
1194486921 X:94496488-94496510 ATGTAGCCATAATAAGAGTTGGG - Intergenic
1195435296 X:104836894-104836916 CTGGGGCCATTATTAGGGATAGG - Intronic
1196383638 X:115122255-115122277 CGGTGGCCATATTTACAACTTGG - Intronic
1199548315 X:149031542-149031564 CTCTGGCTATGCTTAGAGCTAGG + Intergenic