ID: 1165149259

View in Genome Browser
Species Human (GRCh38)
Location 19:33751345-33751367
Sequence CCCTTGGATGTCTACGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165149259_1165149262 29 Left 1165149259 19:33751345-33751367 CCTCAGACGTAGACATCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1165149262 19:33751397-33751419 GCTCAGATATGCCTGTGCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165149259 Original CRISPR CCCTTGGATGTCTACGTCTG AGG (reversed) Intronic
900357515 1:2271842-2271864 CCCCAGGATGTCAACCTCTGGGG - Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
908869421 1:68591687-68591709 CAATTGGATTTCTAAGTCTGAGG - Intergenic
913215912 1:116620290-116620312 TCCTTGGAGGTCTAAGGCTGGGG - Intronic
915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG + Exonic
922570105 1:226629562-226629584 CCCTTGTATGTCCTCGACTGAGG - Intergenic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
1071075983 10:81753493-81753515 CCCTTGGATGTCATCCCCTGTGG - Intergenic
1077696230 11:4395308-4395330 CACTTGTATGTCTTCTTCTGAGG + Intergenic
1078674957 11:13401995-13402017 CCCTTGAATGTCTTCTTCTCAGG + Intronic
1087287884 11:96285680-96285702 CCCCTGAATGTCTTCATCTGAGG - Intronic
1087464380 11:98486430-98486452 ACCATGGATGTCAGCGTCTGTGG - Intergenic
1096358865 12:50966353-50966375 CCTTTGGATACCTACCTCTGTGG + Intronic
1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG + Intronic
1107058277 13:36130103-36130125 CCCTGTGATGTCTACGTCCGTGG - Intronic
1107159476 13:37209330-37209352 CCATAGGATGTCCACTTCTGAGG - Intergenic
1107888451 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG + Intergenic
1117666125 14:58058123-58058145 CCCTTGGATACCAACATCTGAGG + Intronic
1120269724 14:82296142-82296164 GCCAAGGATGTCTCCGTCTGAGG - Intergenic
1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG + Intronic
1128389393 15:67173008-67173030 CCCCTCGATGGCTATGTCTGTGG - Intronic
1135914654 16:26594908-26594930 CTCCTGGATCTCTAAGTCTGGGG + Intergenic
1138540177 16:57683044-57683066 CCCTTGGAGGTTTCCTTCTGGGG - Intronic
1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG + Intronic
1159012863 18:63074768-63074790 CCTTTGGATTTCTGCTTCTGAGG + Intergenic
1159889460 18:73940279-73940301 CCCTTGGGTGTCTGAGTGTGGGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1167719721 19:51170280-51170302 CCAGTGTATGTCTATGTCTGTGG + Intergenic
925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG + Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG + Intronic
936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG + Intergenic
939090476 2:137774627-137774649 CGCTTGGATGTCTTCTTTTGAGG + Intergenic
942249309 2:174034100-174034122 CCCCTGGATGTCTCCATTTGGGG - Intergenic
944437394 2:199704855-199704877 TGCTTGGATCTCTATGTCTGTGG - Intergenic
1177243869 21:18497169-18497191 TCCATGGTTGTCTACGTATGTGG + Intergenic
1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG + Intergenic
1179933756 21:44590161-44590183 CCCTTGCATGTCAACGCCAGAGG - Intronic
1181726814 22:24817112-24817134 CCCTTTGATGTGGACATCTGTGG - Intronic
1182003627 22:26941139-26941161 GCCTTGCATGCCCACGTCTGGGG - Intergenic
1183282378 22:36938506-36938528 CCCTTGCCTGTCTAGGCCTGGGG - Exonic
1183292468 22:37011127-37011149 GCCTTGGCTGCCTACCTCTGCGG - Exonic
1184080191 22:42213843-42213865 CTCTTGGAGGTCTTCTTCTGAGG + Exonic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185423374 22:50748218-50748240 CCCTTAGATGTCTAGGTCCCTGG - Intergenic
954012521 3:47654603-47654625 CCCTTGAACTTCTAAGTCTGTGG - Intronic
961062915 3:123847257-123847279 CCCTTGGGTGTCAAAATCTGTGG - Intronic
962434126 3:135348833-135348855 CTCTTGGTTGTGTAAGTCTGTGG - Intergenic
964181602 3:153894233-153894255 GCCTGGGATGTCTAAGACTGAGG - Intergenic
967172650 3:186834722-186834744 CACTTGGATGTCTTCTTTTGAGG - Intergenic
978399308 4:108314107-108314129 CCCTGGGATGTCTTGGTCTTGGG - Intergenic
1001670554 5:173469875-173469897 CCATTGCATGGATACGTCTGTGG - Intergenic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1012467176 6:99529161-99529183 CCCTTGGATACCAAAGTCTGTGG - Intergenic
1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG + Intergenic
1015984941 6:138875414-138875436 CCCTTGGATGTCCAGGGATGAGG - Intronic
1022025547 7:26444613-26444635 CCCTTGGATGTCTAGGACCAGGG + Intergenic
1029639801 7:101814051-101814073 CCCTGGCATGTCTATTTCTGCGG - Intergenic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG + Intronic
1046171792 8:110517850-110517872 CCCTTGAATGTCTATGTTTTTGG + Intergenic
1052718539 9:32147117-32147139 ACCTGGGATGTGTAGGTCTGAGG - Intergenic
1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG + Intergenic
1058646048 9:107132380-107132402 CCCTAGAATGTCAACCTCTGAGG - Intergenic
1061329378 9:129882741-129882763 ACCTAAGATGTTTACGTCTGAGG - Intergenic