ID: 1165149262

View in Genome Browser
Species Human (GRCh38)
Location 19:33751397-33751419
Sequence GCTCAGATATGCCTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165149261_1165149262 13 Left 1165149261 19:33751361-33751383 CCAAGGGAAATAATTAGTGCTTA 0: 1
1: 0
2: 1
3: 8
4: 240
Right 1165149262 19:33751397-33751419 GCTCAGATATGCCTGTGCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 161
1165149259_1165149262 29 Left 1165149259 19:33751345-33751367 CCTCAGACGTAGACATCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1165149262 19:33751397-33751419 GCTCAGATATGCCTGTGCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165149262 Original CRISPR GCTCAGATATGCCTGTGCTG TGG Intronic
902382865 1:16060797-16060819 GCTCAGATGTTCCTGTGCAATGG + Intronic
902652558 1:17846059-17846081 GCTCAGGTATGCCTGATCTCAGG - Intergenic
904078897 1:27859456-27859478 GCTCAGACATGACTGTGGAGTGG - Intergenic
904172675 1:28602423-28602445 GCACAGACATGCCTATCCTGAGG + Intronic
904261482 1:29290173-29290195 CCTGAGAGTTGCCTGTGCTGTGG - Intronic
905940987 1:41863199-41863221 GGTCAGATCTGCTTCTGCTGGGG + Intronic
906052741 1:42888202-42888224 GCTCAGATATGTCTGTGTGCTGG - Intergenic
906540004 1:46578133-46578155 CCTCAGAGAAGACTGTGCTGTGG - Intronic
906987868 1:50705984-50706006 GCCCAGACATGCCTGTGTGGAGG - Intronic
907410379 1:54279415-54279437 GCTCAGGTCTGCCTGATCTGTGG - Intronic
914166156 1:145176714-145176736 ACTCACAGATGCCTCTGCTGAGG + Intergenic
917657103 1:177137342-177137364 GCTGAGAAAAGCCTGTGATGAGG - Intronic
919744175 1:200998629-200998651 GAGCAGATGTGCCAGTGCTGGGG + Intronic
920101571 1:203520191-203520213 GGTCAGAAATGCCTGGGCTGAGG + Intergenic
921884759 1:220294510-220294532 GCTCAGCAATGCCTGGGCTGAGG - Intergenic
922552312 1:226504855-226504877 GTTCAGCTATGCCTGGGCAGGGG + Intergenic
923093322 1:230755598-230755620 AGTCAGACATGCCTGTGATGTGG + Intronic
923541846 1:234893778-234893800 ACTCAGACATGCCTGTCCTAAGG + Intergenic
1063167262 10:3474513-3474535 GCTCAGTGAAGCATGTGCTGGGG - Intergenic
1063522221 10:6751324-6751346 GCTCAGATATGTCTGAGCAATGG + Intergenic
1065391285 10:25184961-25184983 GACCAGATAGGCCTTTGCTGTGG + Intronic
1067023289 10:42820655-42820677 GCTCCGCAATGCATGTGCTGTGG - Exonic
1068852973 10:61765580-61765602 GCTCAGTTATTGCAGTGCTGTGG - Intronic
1069587754 10:69619915-69619937 GCCTAGATGGGCCTGTGCTGTGG + Intergenic
1069677578 10:70259677-70259699 GTTAAGATATGCCTGTGCTGGGG + Intronic
1070823071 10:79374626-79374648 GCCCAGGTATCCCTGTACTGGGG + Intergenic
1076026979 10:127123453-127123475 GCTCAGATAAGGGTGTGCTGAGG + Intronic
1076519641 10:131073605-131073627 GCAGAGAGCTGCCTGTGCTGTGG + Intergenic
1077114510 11:877341-877363 GCTGAGGAATGCCTGAGCTGTGG - Intronic
1077253026 11:1568948-1568970 GCTCAGCTATGCCAGGGATGGGG + Intronic
1078101961 11:8335188-8335210 GCCCAGAGTTGCCTGAGCTGAGG - Intergenic
1082619262 11:55400313-55400335 TCTCAGAGAAGCCTGGGCTGTGG - Intergenic
1084243212 11:67836967-67836989 CCTGAGATATGCCTGTAATGGGG + Intergenic
1084700156 11:70781403-70781425 TCTCAGAGATGCCTGGGTTGGGG - Intronic
1084780661 11:71406247-71406269 GCTGAGTCATGCATGTGCTGAGG + Intergenic
1084829772 11:71759973-71759995 CCTGAGATATGCCTGTAATGGGG - Intergenic
1084971270 11:72773387-72773409 GCTCAGCTCTGACTGTGCTGTGG - Intronic
1086010795 11:82101022-82101044 GGTCAGATAGACCTGTGCTTGGG + Intergenic
1088578534 11:111296045-111296067 GCTCTTAAATACCTGTGCTGGGG + Intergenic
1088594124 11:111427277-111427299 GCTCAGAGAGGTCTGTGATGTGG - Intronic
1090953547 11:131495439-131495461 GCTCTGCACTGCCTGTGCTGCGG + Intronic
1091290672 11:134437809-134437831 GCTCAGTTATGCCTCTGGAGTGG - Intergenic
1092211788 12:6651115-6651137 GCAGAGGAATGCCTGTGCTGGGG - Exonic
1092413463 12:8271705-8271727 CCTGAGATATGCCTGTCATGGGG + Intergenic
1093772405 12:23033082-23033104 GCTGGGATAAGCCTGTGATGAGG + Intergenic
1096216189 12:49798639-49798661 CCCTAGATCTGCCTGTGCTGTGG - Intronic
1097798812 12:63890684-63890706 GCTCAGGCAGGCCTGTCCTGGGG - Intronic
1099508800 12:83508791-83508813 ACACAGATAAGCCTGTGCTGGGG + Intergenic
1102219989 12:111187800-111187822 GCCCACAGATGTCTGTGCTGGGG + Intronic
1107559765 13:41548314-41548336 GCTCACAGATGCTGGTGCTGGGG - Intergenic
1110494584 13:76151703-76151725 GATCAAATATGCCTGGGCTCAGG + Intergenic
1118694867 14:68374833-68374855 GCTCAGTTTTACCTGCGCTGAGG + Intronic
1120337183 14:83171779-83171801 GCACAGATATACCTATACTGTGG - Intergenic
1123625892 15:22226628-22226650 TCTCACAGATGTCTGTGCTGGGG + Intergenic
1125958886 15:43811888-43811910 GCTCAGAAATGATTCTGCTGGGG + Intronic
1127081228 15:55381843-55381865 TCTGAGATATGCCTGTACTCTGG - Intronic
1127279326 15:57475415-57475437 GGTCAGATATGTCTCTGTTGTGG - Intronic
1128259333 15:66221546-66221568 GCTCAGCTGTGCCAGGGCTGTGG - Intronic
1130555266 15:84918245-84918267 GCACAGGTAGGCCTGTGCTGTGG - Intronic
1131854103 15:96574487-96574509 GCTCAGATGTGCCTGTTTTTTGG - Intergenic
1132613839 16:830744-830766 GCTCAGCTTTGCCTTAGCTGTGG + Intergenic
1132786139 16:1657950-1657972 GCTCACATGTCCCTGTGCTGGGG + Intronic
1133254715 16:4509659-4509681 GAACAGCTATGGCTGTGCTGAGG + Exonic
1134505049 16:14798401-14798423 GCTCTTATTTTCCTGTGCTGAGG + Intronic
1134575526 16:15330508-15330530 GCTCTTATTTTCCTGTGCTGAGG - Intergenic
1134726919 16:16425992-16426014 GCTCTTATTTTCCTGTGCTGAGG + Intergenic
1134940518 16:18285871-18285893 GCTCTTATTTTCCTGTGCTGAGG - Intergenic
1135922429 16:26663277-26663299 GGACAGATGTGCATGTGCTGAGG - Intergenic
1136860428 16:33698053-33698075 GCTCCGCAATGCATGTGCTGTGG + Intergenic
1137364872 16:47852029-47852051 GCTGAGGCATGCCTGTGGTGGGG + Intergenic
1140058548 16:71547117-71547139 ACTCAGAGAAGCCTGAGCTGGGG - Intronic
1140297843 16:73726417-73726439 GGCCAGACATGCCTTTGCTGTGG + Intergenic
1141227585 16:82133537-82133559 ACTAAGAAATGCCCGTGCTGGGG - Intergenic
1142414935 16:89936212-89936234 GCTGAGAGAGGCCTGCGCTGGGG + Intergenic
1147364139 17:39949465-39949487 GCTCACATATGCGTGTGTGGTGG - Intergenic
1147687232 17:42293738-42293760 GCTCAGACATGCCTGTCCACAGG - Intronic
1148328847 17:46800820-46800842 GCTCAGAAGGGCCTTTGCTGGGG + Intronic
1148877276 17:50697289-50697311 GCCCAGCTCTGCCTCTGCTGGGG + Intronic
1149971381 17:61221693-61221715 GCTTAGATGTGCCTGTGGTTGGG + Intronic
1150604535 17:66679540-66679562 GCACAGCTATGTCTGTGCTTTGG - Intronic
1151270296 17:72989259-72989281 GCCAAGATCTGGCTGTGCTGTGG - Intronic
1151651818 17:75474965-75474987 GCCCAGAGAGGGCTGTGCTGGGG + Intronic
1152068708 17:78124888-78124910 GCTCAGATATGCCTGCGTGCTGG - Exonic
1153431447 18:5021919-5021941 CCTGAGATGTGCTTGTGCTGTGG - Intergenic
1155159912 18:23186982-23187004 GCTCTGAAGTGCCTGTGCTATGG - Intronic
1155667161 18:28325292-28325314 GCTCAGTAATGTCAGTGCTGAGG + Intergenic
1157002048 18:43538410-43538432 GCTCAGATTGGCTTGTGGTGTGG + Intergenic
1162110502 19:8397345-8397367 GGACAGAGATGCCTGTCCTGAGG + Intronic
1165149262 19:33751397-33751419 GCTCAGATATGCCTGTGCTGTGG + Intronic
925480878 2:4272683-4272705 GCTCAGCTGTGCCAGTGCAGGGG - Intergenic
929315884 2:40478137-40478159 ACTCAGCTATGCCTTGGCTGGGG + Intronic
933418159 2:82013806-82013828 GCCCAGACAAGCCAGTGCTGCGG + Intergenic
935483323 2:103620743-103620765 GCACAGATATGCCTGGACAGCGG - Intergenic
935763374 2:106342201-106342223 GCCCAGAGATGCCCGTGGTGAGG + Intergenic
937485477 2:122310728-122310750 GCTCACTTCTGCCTGTGCAGTGG + Intergenic
937485915 2:122314598-122314620 GCTCACTTCTGCCTGTGCAGTGG - Intergenic
938105482 2:128527079-128527101 ACTGAGCTATGCCTGTGTTGAGG - Intergenic
938737121 2:134196238-134196260 GTTTGGATATGCCTGTGCTTGGG + Intronic
940992222 2:160109398-160109420 GCTAAGAAATGCCTGGGGTGGGG + Intronic
943302426 2:186220710-186220732 GCTTTTATATGCCTGTACTGTGG - Intergenic
1169734196 20:8819903-8819925 CCTCAGATATGCCAGTGTAGAGG + Intronic
1171818064 20:29806144-29806166 GATCAGATATGCCTGTTTAGTGG - Intergenic
1174147675 20:48463474-48463496 CCTCAGACATCCCTGTCCTGTGG - Intergenic
1175456445 20:59118662-59118684 ACACAGAAATGCCTGTGATGTGG + Intergenic
1175496331 20:59417041-59417063 GCTCAGAGACCCCTGTGCTCAGG + Intergenic
1175741741 20:61424773-61424795 CCTCAGTCATCCCTGTGCTGTGG + Intronic
1180511919 22:16099961-16099983 GGACAGATATGTGTGTGCTGTGG - Intergenic
1181481851 22:23204929-23204951 GGTCAGGAATGCATGTGCTGAGG + Intronic
1181575139 22:23789220-23789242 GTTCAAAGATGCCAGTGCTGGGG + Intronic
1181919299 22:26307754-26307776 CCTCAGATCTGCCTCTTCTGAGG + Intronic
1183246522 22:36697821-36697843 GCTCAGAGGTGTCTGTTCTGGGG + Intronic
1184664984 22:45983615-45983637 GCTCAGAAATGCCTCTCCAGTGG - Intergenic
950951981 3:17009955-17009977 GGTCAGAAATGCCATTGCTGCGG - Exonic
956661099 3:71598638-71598660 GGTCAGATAATTCTGTGCTGTGG - Intergenic
957088418 3:75704983-75705005 GATCAGATATGCCTGTTTAGTGG + Intergenic
961891017 3:130130355-130130377 CCTGAGATATGCCTGTAATGGGG + Intergenic
962756267 3:138467687-138467709 GCCCAGCTATTCCTATGCTGTGG + Intronic
968266690 3:197368394-197368416 GCTCAAATCTGCCATTGCTGAGG + Intergenic
969002405 4:3992779-3992801 CCTGAGATATGCCTGTAATGGGG + Intergenic
969751604 4:9115739-9115761 CCTGAGATATGCCTGTAATGGGG - Intergenic
969811521 4:9652033-9652055 CCTGAGATATGCCTGTAATGGGG - Intergenic
973122217 4:46535744-46535766 GTTCAGATAAGGCTTTGCTGGGG - Intergenic
976301977 4:83523901-83523923 GCTCAGGGTTGCCTGTGTTGGGG + Intergenic
982205808 4:152996407-152996429 GCTCAGACAAGGCTGTGCTGAGG - Intergenic
984523397 4:180827263-180827285 GCTGAGATCTGCCGCTGCTGAGG + Intergenic
985718513 5:1476292-1476314 GTTCAGAGCTGCCTGTGGTGGGG + Intronic
985763687 5:1765285-1765307 GCTGAGAGGTGCCCGTGCTGTGG - Intergenic
986202617 5:5591801-5591823 ACCCAGAGATGCCTGTGCTTAGG + Intergenic
986821215 5:11468902-11468924 AGTCACATTTGCCTGTGCTGTGG + Intronic
987597761 5:20023256-20023278 CCTCAGCTTTGCCTGTGCTCAGG + Intronic
988794367 5:34638826-34638848 GCTCAGATATGCCTGCTCCTAGG + Intergenic
988981900 5:36578827-36578849 GATCAGAGCTGCCTGTGCAGTGG - Intergenic
989274070 5:39566454-39566476 ACGTAGATATGCATGTGCTGTGG + Intergenic
998830951 5:146158220-146158242 TCTCAGATAGGACTGTCCTGAGG + Intronic
1001134121 5:169088504-169088526 GCTCAGAAATGCCGTTGCTATGG - Intronic
1002886541 6:1301310-1301332 GCCCAAATATTCCTGTTCTGAGG - Intergenic
1003174206 6:3743262-3743284 GCTCAGAGAGGCCTGTTCTTTGG - Intronic
1003475801 6:6481578-6481600 TCTCAGAGAGCCCTGTGCTGAGG - Intergenic
1006797791 6:36742266-36742288 GTTCAGATGTGCGTGTGCAGGGG + Exonic
1010242706 6:73631288-73631310 GCTCAGACATGACTGTGGAGTGG - Intronic
1014624482 6:123709118-123709140 ACTCACATATTCCTGTGCTTTGG - Intergenic
1015562346 6:134530128-134530150 CCTCAGATAACCCTGTGATGTGG - Intergenic
1019910133 7:4095312-4095334 GCTCAGATATGGGGGAGCTGAGG - Intronic
1019928661 7:4209302-4209324 GCTCAGAAGTGCCTGTGAAGTGG - Intronic
1019938460 7:4271294-4271316 GAGCAGGTTTGCCTGTGCTGTGG + Intergenic
1021392807 7:20115112-20115134 GATGAGACATGCCTGTGATGGGG - Intergenic
1022276722 7:28862540-28862562 GCTTGGAGAAGCCTGTGCTGGGG + Intergenic
1023152944 7:37219211-37219233 ACTGAGAGAGGCCTGTGCTGGGG - Intronic
1023860442 7:44215013-44215035 GCTCAGCTTTTCCTGTTCTGAGG + Intergenic
1024181582 7:46900654-46900676 GACCAGATCTTCCTGTGCTGGGG + Intergenic
1024510464 7:50200069-50200091 GCTCAGATAAGCCAGTGGGGAGG + Intergenic
1024912377 7:54459722-54459744 ACTCAGGGATGCCTGTGCTAGGG - Intergenic
1027541878 7:79477105-79477127 TCTCTGCTCTGCCTGTGCTGAGG - Intergenic
1035072595 7:156156329-156156351 GCTGTGATATGTGTGTGCTGTGG + Intergenic
1035279198 7:157766622-157766644 CCTCACAAATGCCTGTGCTGCGG + Intronic
1035357514 7:158285449-158285471 GCTCAGCTCTGCTTGTGCTGGGG - Intronic
1035523128 8:291125-291147 TGTCAGATATGCGTGTGCAGAGG + Intergenic
1036374816 8:8191164-8191186 CCTGAGATATGCCTGTAATGCGG - Intergenic
1036388715 8:8306120-8306142 ACTCAGACATGCCTTTACTGGGG + Intergenic
1036854728 8:12231988-12232010 CCTGAGATATGCCTGTAATGCGG + Intergenic
1036876086 8:12474480-12474502 CCTGAGATATGCCTGTAATGCGG + Intergenic
1039856324 8:41417380-41417402 TGTGAGATATGCCTGCGCTGGGG - Intergenic
1046774876 8:118153326-118153348 GCTCAAATGTGCTTGTGCAGTGG - Intergenic
1047753673 8:127901402-127901424 CCTAAAATGTGCCTGTGCTGTGG - Intergenic
1056008653 9:82302270-82302292 GCTCAGATATTCCTCTCCTGGGG - Intergenic
1061398268 9:130355063-130355085 ACTCAGAGCTGCCTGGGCTGTGG + Intronic
1062043479 9:134414798-134414820 GCTGAGATCTGCGTGTGCGGGGG + Intronic
1186218100 X:7321913-7321935 GCTCAGACAGGCCAGGGCTGAGG - Intronic
1189300955 X:39951904-39951926 GCTCAGATGGGCATATGCTGTGG - Intergenic
1189734454 X:44055538-44055560 GCAAATATATGCCTGTGATGTGG - Intergenic
1191159372 X:57311823-57311845 ACTCAGTTCTGCCTGTGCTAGGG - Intronic
1191239566 X:58173253-58173275 GCTCAGAAATGCCTGTGTGAAGG - Intergenic
1198435072 X:136609258-136609280 GCTTAGAAATGCCTCTGGTGAGG - Intergenic
1201494825 Y:14581725-14581747 GGTCAGAGATGCTTGTGCAGTGG + Intronic