ID: 1165152108

View in Genome Browser
Species Human (GRCh38)
Location 19:33766941-33766963
Sequence CTCAAACTCCACCACAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165152102_1165152108 12 Left 1165152102 19:33766906-33766928 CCCATCAGGAAATCCCAAAAGAC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152103_1165152108 11 Left 1165152103 19:33766907-33766929 CCATCAGGAAATCCCAAAAGACC 0: 1
1: 0
2: 0
3: 20
4: 430
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152105_1165152108 -2 Left 1165152105 19:33766920-33766942 CCAAAAGACCAAGAAGCACGACT 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152106_1165152108 -10 Left 1165152106 19:33766928-33766950 CCAAGAAGCACGACTCAAACTCC 0: 1
1: 0
2: 1
3: 3
4: 104
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152101_1165152108 13 Left 1165152101 19:33766905-33766927 CCCCATCAGGAAATCCCAAAAGA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152104_1165152108 -1 Left 1165152104 19:33766919-33766941 CCCAAAAGACCAAGAAGCACGAC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1165152100_1165152108 25 Left 1165152100 19:33766893-33766915 CCACACAAACGGCCCCATCAGGA 0: 1
1: 0
2: 1
3: 24
4: 126
Right 1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165152108 Original CRISPR CTCAAACTCCACCACAGACA GGG Intronic
900383675 1:2399055-2399077 CTCAAGCTACACCACAGGCTCGG - Intronic
901448317 1:9321323-9321345 CTAGAGCTCCACCACACACACGG - Intronic
902465967 1:16619080-16619102 CTCAGACTCCTTCAGAGACAAGG + Intergenic
902508724 1:16954224-16954246 CTCAGACTCCTTCAGAGACAAGG - Exonic
904604215 1:31690153-31690175 CTCTGCCTCCACCACACACATGG - Intronic
904713422 1:32448625-32448647 CTCTAACTCCCCCAGAGAAAGGG - Intergenic
905980164 1:42218169-42218191 CTCAGACTCCACCTCAGAGAGGG + Intronic
907424322 1:54369669-54369691 CTCAACCTCCACCTCAAACCTGG + Intronic
907919961 1:58903294-58903316 CTCAAACAGCACCTCAGACCAGG - Intergenic
908607648 1:65817217-65817239 GGCTAACTCCACCAAAGACAGGG - Intronic
908802710 1:67896964-67896986 CTGGAACTGCACCAGAGACATGG - Intergenic
909985658 1:82157965-82157987 CTTAAACACCACCCCAGATATGG + Intergenic
911296945 1:96129161-96129183 TTCACAATCTACCACAGACAAGG + Intergenic
913995940 1:143652082-143652104 CACGAACACCACCGCAGACAAGG + Intergenic
917223894 1:172761341-172761363 GACCACCTCCACCACAGACAAGG - Intergenic
919510930 1:198463044-198463066 CTAAAACTGCACCAGAGACAGGG - Intergenic
921064750 1:211614759-211614781 CTCTAAGTCCACCACACCCACGG + Intergenic
924803757 1:247346822-247346844 CTCAACCTGTACCACAGACTGGG + Intergenic
1062897520 10:1115774-1115796 CTCCACCTTCCCCACAGACAAGG - Intronic
1063139828 10:3245994-3246016 CCAAAACTCCAGCACAGAAATGG - Intergenic
1064258936 10:13769261-13769283 CATAAAATACACCACAGACACGG - Intronic
1065029099 10:21567296-21567318 CTCAAATGTCAACACAGACAAGG - Intronic
1065227427 10:23558734-23558756 CTAAAATTGCACCACAGAGAGGG - Intergenic
1066265399 10:33771806-33771828 GTCAAAATCCACCAAAAACAAGG + Intergenic
1070426132 10:76289458-76289480 CTTAAAGTGCTCCACAGACATGG + Intronic
1071368360 10:84924598-84924620 CTAAAACTCCAACAGAGAAATGG - Intergenic
1073077239 10:100831805-100831827 CTCCAGGTCCACCCCAGACAGGG + Intergenic
1074818229 10:117160354-117160376 CTCAGACTCTACCACACAGATGG + Intergenic
1076395479 10:130135412-130135434 CTTGAACTTCAACACAGACAGGG - Intergenic
1077697718 11:4409874-4409896 CTCAATCTCCAACATAGAGAGGG - Intergenic
1078109957 11:8384401-8384423 CTCTAACTCCTCCAAAGAAAGGG - Intergenic
1078627495 11:12970922-12970944 CTCCAACCCCACCCCAGCCAAGG + Intergenic
1078720559 11:13880035-13880057 CTCAAACTCCAGCCCAGGTACGG + Intergenic
1082756778 11:57084350-57084372 ATCAACATCCACCACAGAAAAGG + Intergenic
1083742567 11:64718596-64718618 CTCGAACACCCCCACAGACGGGG - Intronic
1088559447 11:111097797-111097819 CTCAGACTCCACCAGAGCGAGGG - Intergenic
1088892188 11:114053671-114053693 CTCAAAGCCCACCACAGCCTTGG + Intergenic
1093210760 12:16305710-16305732 CTAAAACTCAACCAAAAACAAGG - Intergenic
1094361390 12:29635022-29635044 CTCAAACCCCAACAAAGACATGG + Intronic
1099186381 12:79519986-79520008 CTCAACCTCCACCTGAGAAAAGG + Intergenic
1100410202 12:94309794-94309816 CTCAAAATTCACCACAAAAATGG - Intronic
1101106014 12:101440827-101440849 TTCAAATGCCACCACAGAGAGGG + Intergenic
1104584584 12:130037771-130037793 CAGAAACTCCAGCACAGCCATGG - Intergenic
1104806710 12:131594060-131594082 TTCAAAATCCACCTCTGACACGG - Intergenic
1105517415 13:21103150-21103172 GTCAAGGTCCACCACAGACATGG + Intergenic
1105768138 13:23580551-23580573 GTGAAACTGCACCACAGAAAAGG - Intronic
1106597778 13:31161562-31161584 GTCCAACCCCACCACCGACATGG + Exonic
1107806304 13:44156975-44156997 CTGAAAACCCACCACATACAAGG + Intronic
1118323117 14:64764846-64764868 GACACAGTCCACCACAGACAGGG + Intronic
1121127920 14:91419341-91419363 CTGAAACTCCTCCACAGCGATGG - Intergenic
1121254206 14:92519577-92519599 CTCAGACTCCAACCCTGACAGGG - Intronic
1122069988 14:99200077-99200099 ACCAAATTCCACCACAGACAGGG + Intronic
1122499544 14:102187620-102187642 CTCCCACTCCACCACTGCCACGG - Intronic
1123579541 15:21703949-21703971 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1123616168 15:22146460-22146482 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1124039550 15:26088059-26088081 CTGAGACTCCAGCACAGCCATGG + Intergenic
1126030427 15:44491872-44491894 GTGAGACTCCACCCCAGACAGGG - Intronic
1126109903 15:45169017-45169039 CTGAAACTCAAGCACAGGCAAGG + Intronic
1126683518 15:51226667-51226689 CCCAGATTCCACCACTGACAAGG + Intronic
1127323258 15:57867890-57867912 CTCAGACTCCCCCGCAAACACGG + Intergenic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1129128091 15:73463290-73463312 ATTAAACTGCACCACAGAGATGG - Intronic
1129476804 15:75791266-75791288 CTCAGACTGCACGACAGATACGG + Intergenic
1132237467 15:100232884-100232906 CTCACACTCCACCCCAGAGGAGG + Intronic
1132435629 15:101799362-101799384 CTATAACTCAACCACAGAAAGGG - Intergenic
1202988411 15_KI270727v1_random:438194-438216 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1132624386 16:883587-883609 CACACCCTCCACCCCAGACAGGG + Intronic
1134763963 16:16739527-16739549 CTCCACCTCCTCCACAGAAAGGG - Intergenic
1135549352 16:23386310-23386332 CTTAAACCTCACCACAGACTGGG - Intergenic
1136015297 16:27395353-27395375 CTCAAACTCCTCCACAAAACAGG + Intergenic
1137477688 16:48824706-48824728 ATCAAACTCCACCTCAGAGTTGG + Intergenic
1137960895 16:52881194-52881216 CACAAACTTCCCCACAGCCATGG - Intergenic
1141056164 16:80816610-80816632 CTGAAGCTCCACCACGGAAAAGG + Intergenic
1142441365 16:90100404-90100426 CTCAGCCCCAACCACAGACATGG + Intergenic
1143581891 17:7832625-7832647 CTCAAACTGCTCCACACGCATGG - Exonic
1144631981 17:16878452-16878474 CTCCAACTACAGCACAGTCATGG - Intergenic
1150007604 17:61479389-61479411 CCTAAAATCCACCACAGCCACGG - Intronic
1151227678 17:72658788-72658810 ATAAAACTCCCCCACCGACAGGG + Intronic
1152561136 17:81079331-81079353 CTCTACCTCCACCTCAGACGGGG - Intronic
1155978265 18:32154973-32154995 CTCAAAAACAATCACAGACATGG - Intronic
1156349734 18:36293871-36293893 CTCCAACTCTACCCCAAACAAGG - Intergenic
1156857568 18:41800117-41800139 CTCGGACTCCTCCAGAGACAAGG - Intergenic
1157216749 18:45790344-45790366 CTCAAATTCACTCACAGACATGG + Intergenic
1159646722 18:70927002-70927024 CTCAGAATCCACCTGAGACAAGG + Intergenic
1159984519 18:74826434-74826456 CTCAAACACTACCACACACACGG - Intronic
1160739029 19:677464-677486 CTCAAACACCACCAAACACCAGG - Intronic
1161865445 19:6829259-6829281 CCCAGGCTCCACCACAGATATGG - Intronic
1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG + Intronic
1165493558 19:36139617-36139639 CTCAATCCTCGCCACAGACACGG + Exonic
1166180007 19:41102345-41102367 ATCAAACTTCACCACAATCAAGG + Intergenic
1167313721 19:48752253-48752275 CGCAAAATCCACCACAGAGGTGG + Intronic
925175647 2:1781889-1781911 CTCAAAGAACACCACAGCCAAGG - Intergenic
925545776 2:5014533-5014555 CTTAAGCTCCACCACCAACAAGG - Intergenic
926802349 2:16669691-16669713 CTCCAACTCAGCCACAGGCAAGG - Intergenic
933120693 2:78533327-78533349 CTCAAACTCCCCTTCAGAAAAGG - Intergenic
934884618 2:98013781-98013803 CTTAAGCTTCACCACAGGCAGGG - Intergenic
936043205 2:109165544-109165566 CACACAGTCCCCCACAGACAAGG - Intronic
936412036 2:112268580-112268602 CACAAACTCCACCATTGCCATGG - Intergenic
939289260 2:140172142-140172164 CTCAACCTCCACCAGAAACCTGG + Intergenic
939427945 2:142065078-142065100 ATGAAACTCTACCACAGACATGG - Intronic
941314278 2:163973141-163973163 CTCTAATGCCACCACACACAAGG + Intergenic
943581638 2:189691035-189691057 CTCAAATTCCAGCAAAGACTAGG - Intronic
943650737 2:190455087-190455109 CTCCAACTCCACCACTCAGAAGG - Intronic
943722969 2:191224160-191224182 GTCAAGCACCACCACAGGCAAGG + Intergenic
944949763 2:204734850-204734872 CTCAAACTTTACCACTGAAATGG + Intronic
946143354 2:217710508-217710530 CTCACACTCCAGGACAGGCATGG + Intronic
948173771 2:235927604-235927626 GTCAATCTCAACCCCAGACAAGG - Intronic
948175682 2:235940786-235940808 TTCTAACTCCACCACAGAGAGGG + Intronic
1170243402 20:14194590-14194612 CTCTAACTCCACTGAAGACAGGG + Intronic
1170819637 20:19745495-19745517 TTCATACTCCAACACATACAGGG + Intergenic
1171484945 20:25479704-25479726 CTCAAAAGCCACCACAGTCTAGG + Intronic
1172386424 20:34537130-34537152 CTCATCCTCCTCCACTGACAAGG - Intronic
1174549000 20:51347991-51348013 CTCAAATTCCATCACTGACTGGG - Intergenic
1175122593 20:56727694-56727716 CACAACCTCAACCACAGCCAGGG - Intergenic
1176185512 20:63776167-63776189 CTGAGACTCCACCGCAGCCATGG - Intronic
1178568537 21:33712616-33712638 CTAAAACTCCAACAGAAACACGG - Intronic
1179583374 21:42359297-42359319 CTTAGACTCCAGCACAGTCACGG - Intergenic
1179768320 21:43592227-43592249 CTCAAAAGCCACCACAGCAAAGG + Exonic
1179931404 21:44573346-44573368 CTCATAGTCCAGCACACACACGG + Intronic
1181481660 22:23203712-23203734 AGCAAACTTCACAACAGACAAGG - Intronic
949350127 3:3117380-3117402 CTCTGTCTCCACCACAGAGATGG + Intronic
950498410 3:13348267-13348289 CTCAAATGCCTCCAGAGACAGGG + Intronic
950684013 3:14603326-14603348 CTCAGTCTCCCCCACACACAGGG + Intergenic
953500593 3:43429558-43429580 CTAAAACTCTTCCAGAGACAAGG + Intronic
953530257 3:43734288-43734310 CACAAATTGCACCACAGACTGGG - Intronic
954139546 3:48597814-48597836 CTCAAACTTGACAACAGACTTGG + Intergenic
954546588 3:51441271-51441293 TTCTAACTCTACCACAAACAAGG - Intronic
955469300 3:59269575-59269597 TTCAAGCTCCACCAGACACAAGG - Intergenic
958476003 3:94583894-94583916 CTCACTCCCCACCACAAACATGG + Intergenic
959519809 3:107312554-107312576 CTCAAAAATCAGCACAGACAAGG - Intergenic
960532570 3:118781507-118781529 CTGAAACTCCAAAACAGACTGGG - Intergenic
962071862 3:132041995-132042017 CTCCAAGTCAAGCACAGACAAGG + Intronic
962680635 3:137796163-137796185 CTCAAACCCCACCACTGAAACGG - Intergenic
963087962 3:141455814-141455836 CTGAAACTCCATCACAAACTCGG - Intergenic
965662506 3:171056477-171056499 TTCAAACTCCCCCTCAGATAAGG - Intergenic
968680188 4:1913335-1913357 CTCTAACTCCCCCACGGAAAGGG - Intronic
969491952 4:7504552-7504574 TTCAAATCCCACCACAGCCATGG - Intronic
977221730 4:94345380-94345402 CCCAAACCCAACCACAGAAAAGG - Intergenic
980762099 4:137248047-137248069 CTCAGACTCCACCACAGACCTGG - Intergenic
981882821 4:149636181-149636203 GACAAACTCCTCCACAGAGATGG + Intergenic
981943889 4:150318090-150318112 CTCAAACTCTGCCACTGACTGGG - Intronic
981944065 4:150320184-150320206 CTCAAACTCCGCCACTGACTGGG + Intronic
982260034 4:153487033-153487055 CTCAGACCCCACCCCAGACCTGG + Intronic
987510226 5:18828024-18828046 CTCAACACCCAACACAGACAAGG + Intergenic
990582014 5:57174264-57174286 CTCAAACCCCAACACGGACACGG - Intronic
990817660 5:59803770-59803792 CTCATGCTTCAACACAGACAAGG + Intronic
996193766 5:120578395-120578417 CTCAACCTCCACCCCCGAAAAGG + Intronic
997721342 5:136080523-136080545 CTCGAACCCCAGCACAGAGATGG + Intergenic
1000119041 5:158179307-158179329 CTCAAACACCAGCACTGACCTGG + Intergenic
1000245698 5:159446935-159446957 CTCCAACACCACCACAGCCAAGG + Intergenic
1001282369 5:170396005-170396027 CTGAAAATCCACCACAGTGATGG + Intronic
1001933644 5:175689747-175689769 CTCCAACTCCAGCACAGATGCGG + Intergenic
1004071289 6:12300314-12300336 CTTAAACTCCTCCAGAGCCAAGG + Intergenic
1007641953 6:43348323-43348345 CTCAAACTCCTCCTCCAACAAGG - Exonic
1015725484 6:136295249-136295271 CTCAAAATCCAGCAGAGAGAGGG + Intergenic
1020091703 7:5345608-5345630 CTCCAGCTGTACCACAGACAGGG + Exonic
1024780477 7:52842353-52842375 CTCAAATTGCACCCCAGATATGG + Intergenic
1026004295 7:66588890-66588912 CTCCAACTTCCCCACTGACAGGG + Intergenic
1026026941 7:66753102-66753124 CTCCAACTTCCCCACTGACAGGG - Intronic
1028408582 7:90503250-90503272 GTCAAAGTCTAACACAGACAAGG - Intronic
1030345879 7:108432571-108432593 CTCACACTGCAATACAGACATGG + Intronic
1030377140 7:108766380-108766402 CTATGTCTCCACCACAGACATGG + Intergenic
1031455373 7:121972566-121972588 CTGAAACTCCTCCGCTGACACGG - Exonic
1033713405 7:143974067-143974089 CTCCAACTCCAGCACTCACAGGG + Intergenic
1034436546 7:151065285-151065307 CTCCCACTACACCACAGGCAGGG - Intronic
1036043483 8:5113242-5113264 CTCAAAATCCACTCCAGACCAGG - Intergenic
1036285501 8:7441550-7441572 CTAAAGATCCACCCCAGACAAGG + Intergenic
1036335973 8:7869979-7870001 CTAAAGATCCACCCCAGACAAGG - Intergenic
1039455220 8:37701357-37701379 CACAAACTCGACGACAGACAGGG + Intergenic
1041505330 8:58591152-58591174 TTAAAAATCCAGCACAGACATGG + Intronic
1042159879 8:65881929-65881951 CTCCAACACCACCAAACACAAGG - Intergenic
1043706015 8:83351969-83351991 CTCAATATCCACCATAGACAAGG + Intergenic
1047982741 8:130199784-130199806 CTCAAACTGCCTCAGAGACAGGG + Intronic
1048647134 8:136434455-136434477 GTCAGACTCCACCTCAGAGATGG + Intergenic
1052342968 9:27381095-27381117 CTCAAACTCTACTGCAGGCATGG + Intronic
1053023288 9:34710063-34710085 CTCACCCTCTACCACAGACATGG - Exonic
1056888531 9:90467989-90468011 CTCCAACTTCAACAAAGACAAGG - Intergenic
1057125905 9:92615985-92616007 GTCAAGGTCCAGCACAGACACGG + Exonic
1059328808 9:113522192-113522214 CTCACACTCTAGTACAGACATGG - Intronic
1061499338 9:130993231-130993253 CTCTGACCCCACCACAGACGAGG - Intergenic
1187475422 X:19606720-19606742 CTCAGACCCCACCCCAGACATGG - Intronic
1191041260 X:56083063-56083085 CTCAAACTTGAGGACAGACAAGG - Intergenic
1193363355 X:80601336-80601358 CTCAAATTCCTCCACAGAGGAGG - Intergenic
1195241623 X:102958777-102958799 CTCAAATTACACCACAGTTAAGG - Intergenic
1195668972 X:107453257-107453279 CTCAAACCCCAACACATACCTGG + Intergenic