ID: 1165156692

View in Genome Browser
Species Human (GRCh38)
Location 19:33793069-33793091
Sequence TAAAGGGAGTGACGAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165156692_1165156706 21 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156706 19:33793113-33793135 CTAACTAGGAGGGAAGATTGGGG No data
1165156692_1165156697 -5 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156697 19:33793087-33793109 CTTTAGTCTCCAGATTCTCTGGG No data
1165156692_1165156696 -6 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156696 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
1165156692_1165156707 22 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data
1165156692_1165156701 10 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156701 19:33793102-33793124 TCTCTGGGGTCCTAACTAGGAGG No data
1165156692_1165156705 20 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156705 19:33793112-33793134 CCTAACTAGGAGGGAAGATTGGG No data
1165156692_1165156702 11 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156702 19:33793103-33793125 CTCTGGGGTCCTAACTAGGAGGG No data
1165156692_1165156708 23 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156708 19:33793115-33793137 AACTAGGAGGGAAGATTGGGGGG No data
1165156692_1165156700 7 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156700 19:33793099-33793121 GATTCTCTGGGGTCCTAACTAGG No data
1165156692_1165156698 -4 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156698 19:33793088-33793110 TTTAGTCTCCAGATTCTCTGGGG No data
1165156692_1165156703 19 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156703 19:33793111-33793133 TCCTAACTAGGAGGGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165156692 Original CRISPR TAAAGGGAGTGACGAAACAT GGG (reversed) Intergenic
No off target data available for this crispr