ID: 1165156695

View in Genome Browser
Species Human (GRCh38)
Location 19:33793086-33793108
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165156695_1165156705 3 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156705 19:33793112-33793134 CCTAACTAGGAGGGAAGATTGGG No data
1165156695_1165156703 2 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156703 19:33793111-33793133 TCCTAACTAGGAGGGAAGATTGG No data
1165156695_1165156708 6 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156708 19:33793115-33793137 AACTAGGAGGGAAGATTGGGGGG No data
1165156695_1165156702 -6 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156702 19:33793103-33793125 CTCTGGGGTCCTAACTAGGAGGG No data
1165156695_1165156710 16 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156710 19:33793125-33793147 GAAGATTGGGGGGATTCCCAGGG No data
1165156695_1165156706 4 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156706 19:33793113-33793135 CTAACTAGGAGGGAAGATTGGGG No data
1165156695_1165156701 -7 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156701 19:33793102-33793124 TCTCTGGGGTCCTAACTAGGAGG No data
1165156695_1165156711 22 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156711 19:33793131-33793153 TGGGGGGATTCCCAGGGTAGAGG No data
1165156695_1165156713 28 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156713 19:33793137-33793159 GATTCCCAGGGTAGAGGCGGAGG No data
1165156695_1165156700 -10 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156700 19:33793099-33793121 GATTCTCTGGGGTCCTAACTAGG No data
1165156695_1165156709 15 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156709 19:33793124-33793146 GGAAGATTGGGGGGATTCCCAGG No data
1165156695_1165156712 25 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156712 19:33793134-33793156 GGGGATTCCCAGGGTAGAGGCGG No data
1165156695_1165156707 5 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165156695 Original CRISPR CCAGAGAATCTGGAGACTAA AGG (reversed) Intergenic
No off target data available for this crispr