ID: 1165156707

View in Genome Browser
Species Human (GRCh38)
Location 19:33793114-33793136
Sequence TAACTAGGAGGGAAGATTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165156692_1165156707 22 Left 1165156692 19:33793069-33793091 CCCATGTTTCGTCACTCCCTTTA No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data
1165156699_1165156707 -5 Left 1165156699 19:33793096-33793118 CCAGATTCTCTGGGGTCCTAACT No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data
1165156695_1165156707 5 Left 1165156695 19:33793086-33793108 CCTTTAGTCTCCAGATTCTCTGG No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data
1165156694_1165156707 6 Left 1165156694 19:33793085-33793107 CCCTTTAGTCTCCAGATTCTCTG No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data
1165156693_1165156707 21 Left 1165156693 19:33793070-33793092 CCATGTTTCGTCACTCCCTTTAG No data
Right 1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165156707 Original CRISPR TAACTAGGAGGGAAGATTGG GGG Intergenic
No off target data available for this crispr