ID: 1165157346

View in Genome Browser
Species Human (GRCh38)
Location 19:33796503-33796525
Sequence CCGCGCGCGCCCGTTCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165157340_1165157346 -1 Left 1165157340 19:33796481-33796503 CCGAGCCCCGAGCCAGGAGTCGC 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157335_1165157346 18 Left 1165157335 19:33796462-33796484 CCTCTGCCCCGCGGCGCAGCCGA 0: 1
1: 0
2: 2
3: 21
4: 179
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157336_1165157346 12 Left 1165157336 19:33796468-33796490 CCCCGCGGCGCAGCCGAGCCCCG 0: 1
1: 0
2: 2
3: 25
4: 236
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157341_1165157346 -6 Left 1165157341 19:33796486-33796508 CCCCGAGCCAGGAGTCGCCGCGC 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157337_1165157346 11 Left 1165157337 19:33796469-33796491 CCCGCGGCGCAGCCGAGCCCCGA 0: 1
1: 0
2: 1
3: 16
4: 136
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157342_1165157346 -7 Left 1165157342 19:33796487-33796509 CCCGAGCCAGGAGTCGCCGCGCG 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157343_1165157346 -8 Left 1165157343 19:33796488-33796510 CCGAGCCAGGAGTCGCCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91
1165157338_1165157346 10 Left 1165157338 19:33796470-33796492 CCGCGGCGCAGCCGAGCCCCGAG 0: 1
1: 0
2: 1
3: 18
4: 137
Right 1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165157346 Original CRISPR CCGCGCGCGCCCGTTCGCGC TGG Intronic
901696672 1:11012870-11012892 CCGCGCGAGCCCGCTCGGGCAGG - Intronic
901934453 1:12618045-12618067 TCGCGCGCGCTCGCTCGCTCCGG + Intergenic
903652865 1:24931910-24931932 CCGCGCGCCCTCGGACGCGCTGG + Intronic
915302976 1:154962003-154962025 TCGCGCGCGCCCCTCCGCGGCGG - Intronic
922612433 1:226940333-226940355 CCGCGCCCGCCTCTGCGCGCTGG - Intronic
1062874068 10:931444-931466 CCGCGGGCGGCCGGTCGGGCGGG - Exonic
1065637539 10:27745981-27746003 CCGCGCCCGCCCGGCCGCGGGGG + Exonic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1069615138 10:69802012-69802034 CCGTGTGCGCCCCTTCGCCCGGG + Exonic
1076404684 10:130203895-130203917 CCGCCCCCGCCCGATCCCGCCGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1102084397 12:110124285-110124307 CCGCGCGCGCGCGCACGAGCTGG - Intergenic
1103364007 12:120369324-120369346 CCGCGGGCGCCCGGGCTCGCGGG - Intergenic
1104983293 12:132583292-132583314 CCGCGAGCGCCTGGGCGCGCCGG + Exonic
1105004121 12:132710648-132710670 TCGCGAGCGCCGGTGCGCGCAGG - Intergenic
1106665390 13:31846510-31846532 CCGAGCGCGCCGGTGCCCGCAGG + Intergenic
1108542069 13:51453634-51453656 CCGCCCGCGCCCGCTCGCGCCGG - Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113994782 14:16056810-16056832 CCGCCCGCTCCCGTTGGGGCTGG + Intergenic
1115850795 14:37588435-37588457 CCGCGCGCGTCCTAACGCGCGGG + Intergenic
1117253221 14:53955050-53955072 CCGGGCGCGGACGGTCGCGCAGG - Intronic
1119296561 14:73537824-73537846 CGGCGCGAGCCGGTGCGCGCGGG + Exonic
1119306638 14:73612974-73612996 CGGCGCGAGCCGGTGCGCGCGGG + Intronic
1124014342 15:25863127-25863149 CCGCTCACGCCCGCCCGCGCCGG + Exonic
1124696898 15:31870824-31870846 CGGCGCGCGCACGTCCGCGCGGG - Intergenic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1131257350 15:90871465-90871487 CCGCGCGGGGCCGGACGCGCTGG + Intronic
1133024775 16:2983794-2983816 CGGCCCGCGCCTGGTCGCGCGGG - Intergenic
1133286667 16:4693911-4693933 CCGCCCGGGCCCGCCCGCGCCGG - Intronic
1143321149 17:6070227-6070249 CCCCGCGCGCGTGTTCTCGCGGG + Intronic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152468292 17:80477482-80477504 CCGCGCGCGCCCGGTATCCCCGG + Intronic
1157529344 18:48408830-48408852 CCCCGCGCGCCACTTCGCTCCGG + Intronic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160690922 19:460488-460510 CCCCGGGAGCCCGTTCGCGGCGG - Intronic
1160789738 19:917931-917953 CCGCCCGGGCCCGCCCGCGCTGG - Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1160992126 19:1864178-1864200 GGGCGCGCCCCCGTTCGCGATGG + Intergenic
1162914335 19:13865926-13865948 CGGCGCGCGCGCGTTCGTGAAGG + Intronic
1163666624 19:18606661-18606683 CCGCGCGCCCCCGGCAGCGCCGG - Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1180312310 22:11250599-11250621 CCGCCCGCTCCCGTTGGGGCTGG - Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
961762827 3:129184063-129184085 CCGCGCGCGGCCTTTCACGCCGG + Intergenic
962164837 3:133038315-133038337 CCGCGCGCGCCCCTCCGACCAGG - Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964771238 3:160225962-160225984 CCGGGCGCGCCTGGCCGCGCGGG - Exonic
968729255 4:2261985-2262007 CCGCCCGCGCCCGTCCGCCCCGG + Exonic
968803147 4:2756124-2756146 CCGCGCCCGCCTGGCCGCGCTGG - Exonic
969344806 4:6563852-6563874 CCCCGCCCGCCCGCCCGCGCAGG - Intergenic
970394865 4:15655470-15655492 CTGCGCGCGCCCGGTCACGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998166669 5:139848278-139848300 CCGCGCGCGCGCGGCCGCGGCGG + Exonic
998655168 5:144170659-144170681 CGGGGCACGCCCGCTCGCGCAGG + Exonic
1002888251 6:1313695-1313717 TCGCGCGCGCCCAGCCGCGCCGG - Exonic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006123444 6:31821828-31821850 CAGCGCGCACCCGTCTGCGCGGG - Intergenic
1006271984 6:32972075-32972097 GCGCGCGCGCTCGCTCACGCGGG - Exonic
1007702235 6:43771944-43771966 CCGCGCGCACCCGGCCGGGCGGG - Intronic
1012474950 6:99607781-99607803 CGAGGCGCGCCCATTCGCGCGGG + Intronic
1013490991 6:110646313-110646335 CGTCGTGGGCCCGTTCGCGCAGG - Intronic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1024359750 7:48455546-48455568 CAGCTTGCGCCCTTTCGCGCAGG - Intronic
1033461532 7:141551298-141551320 GCGCGCGGGCCAGTTCGGGCCGG - Exonic
1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG + Intronic
1035751917 8:2002314-2002336 CCGCGCGCGCCCGTCCGACCAGG + Exonic
1036910603 8:12754778-12754800 CCGCCCGGGCCCGCTCGCGCTGG + Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1039936583 8:42051601-42051623 CCCCGCGCCCCCGATCCCGCCGG - Intronic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041233118 8:55773140-55773162 CCGCGCGCGTCCGGTCTCCCAGG - Exonic
1044591328 8:93916894-93916916 CCCCGCCCGCACGTTCGGGCCGG - Intronic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1049936414 9:504911-504933 CCGCGGGCTCCCGCTCGTGCGGG + Intronic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1061242715 9:129383672-129383694 CCGGGCGCGCCCGGGTGCGCAGG - Intergenic
1062362291 9:136193692-136193714 CCGCCCGCGCCCGCTCCAGCTGG - Intergenic
1188004087 X:25005496-25005518 CCGCGGCCGCCCTTCCGCGCGGG + Intronic
1189322574 X:40095766-40095788 CGGCGCGCGCCCTGGCGCGCGGG + Intronic
1189323053 X:40097699-40097721 CCGCGAGCGCCCGCTCGGGCTGG + Intronic
1189324605 X:40105136-40105158 AGGCGCGCGGCCGTTCCCGCGGG + Intronic
1190936067 X:55000318-55000340 CCTCCCGCGCGCGTTTGCGCAGG - Intergenic
1199815967 X:151397153-151397175 CCGGAAGTGCCCGTTCGCGCCGG - Intronic
1199815971 X:151397172-151397194 CCGGAAGTGCCCGTTCGCGCCGG - Intronic