ID: 1165157579

View in Genome Browser
Species Human (GRCh38)
Location 19:33797338-33797360
Sequence GGCCGAGCGCCCTGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165157572_1165157579 0 Left 1165157572 19:33797315-33797337 CCCGCACTCTGGCCCCTGTTCTG 0: 1
1: 0
2: 2
3: 49
4: 407
Right 1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 203
1165157571_1165157579 1 Left 1165157571 19:33797314-33797336 CCCCGCACTCTGGCCCCTGTTCT 0: 1
1: 0
2: 4
3: 26
4: 274
Right 1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 203
1165157573_1165157579 -1 Left 1165157573 19:33797316-33797338 CCGCACTCTGGCCCCTGTTCTGG 0: 1
1: 0
2: 2
3: 57
4: 459
Right 1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165157579 Original CRISPR GGCCGAGCGCCCTGCAGAGC TGG Intronic
900363436 1:2300836-2300858 GGCCGAGGACCCTGCAGATCTGG - Intronic
900513396 1:3070522-3070544 GGGCGGGCGGCCTGCAGAGGAGG - Intronic
900908056 1:5574816-5574838 GTCAGAGAGCCCTGAAGAGCTGG - Intergenic
901631136 1:10648773-10648795 GCACGTGCTCCCTGCAGAGCAGG - Intronic
903350033 1:22711539-22711561 GGCCCGGCGCCCCGGAGAGCAGG + Intronic
904337874 1:29809899-29809921 GGCCGAGGGGCAGGCAGAGCTGG - Intergenic
904462048 1:30686036-30686058 GGCCGAGTGGCAGGCAGAGCTGG + Intergenic
904833732 1:33321503-33321525 TGCCGAGTGCCCTTCAGATCTGG - Intergenic
905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG + Intergenic
905562965 1:38941777-38941799 GGAGGAGCGCCTGGCAGAGCGGG - Intronic
908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG + Intergenic
912716893 1:111989587-111989609 CGCCGAGCGCCCAGCAGCGCGGG + Intergenic
915283754 1:154839924-154839946 GGCAGAGAGGCCTGCAGAGCAGG + Intronic
915740188 1:158113423-158113445 TGCCGAGCCCCCTGCCGAGCGGG - Intergenic
916187280 1:162145587-162145609 AGCTGAGCGTCCTGCTGAGCGGG - Intronic
918757478 1:188356329-188356351 GGCTGAGCGCTCCACAGAGCTGG - Intergenic
920022590 1:202967077-202967099 GGCCCAGAGCCCTGCGGGGCGGG + Intronic
920294594 1:204948161-204948183 TGCCTAACTCCCTGCAGAGCTGG + Intronic
920853075 1:209641981-209642003 GGACCAGCTCCCAGCAGAGCTGG - Intronic
921934784 1:220786694-220786716 GGCACAGCGCCCTGCAGCGCAGG + Intergenic
923774551 1:236966683-236966705 AGCCGAGAGCTCTGCAGAGCCGG + Intergenic
1064540728 10:16402816-16402838 GGCACTGCTCCCTGCAGAGCAGG + Intergenic
1070281625 10:75053063-75053085 GGCCGGGAGCGCAGCAGAGCTGG + Intronic
1072612884 10:97030895-97030917 GGCCCAGCCCTCTGCAGAGAGGG + Intronic
1073101110 10:101007181-101007203 GGCAGAGCTCCCTACAGAGCTGG - Exonic
1074187013 10:111106297-111106319 CGCCGGGCGCCGTGCTGAGCAGG + Intergenic
1075397726 10:122140037-122140059 GCCCGACAGCCCTGCAGATCCGG - Intronic
1075713708 10:124544116-124544138 TGCTGAGAGCCCAGCAGAGCTGG + Intronic
1076166688 10:128287726-128287748 GGCCGAGCTCCCTGCTTTGCAGG - Intergenic
1076876780 10:133220131-133220153 GGCCGCGCGCCCAGGAGAGGAGG + Intronic
1076876800 10:133220195-133220217 GGCCGCGCGCCCAGGAGAGGAGG + Intronic
1077410879 11:2403383-2403405 GGGCGAGGGCCCTGTGGAGCTGG + Exonic
1078005836 11:7531601-7531623 GGCCGACAGCCCTGGAGAGGAGG + Intronic
1078141225 11:8694403-8694425 GGCTGAGCACCCTGCAGGGAGGG + Intronic
1080779704 11:35419166-35419188 GGTCGCGCGCCGTGGAGAGCCGG - Exonic
1081808310 11:45901766-45901788 GGCGGAGGGCCATCCAGAGCCGG + Intronic
1083274433 11:61588631-61588653 GGCCGGGCGCCCTGGAAAGGAGG + Intergenic
1083672152 11:64305679-64305701 GGCCGAGCGGCCCGGAGTGCCGG - Intronic
1083709877 11:64541354-64541376 GGCAGGGCACCCTGCAGAGTAGG - Intergenic
1084105021 11:66975452-66975474 GGCTTAGCGCCCTGCGGAGTTGG - Exonic
1084648244 11:70473340-70473362 AGCCCATCACCCTGCAGAGCCGG - Intronic
1085326711 11:75611976-75611998 GGCCGAGCACACTGCAGCTCTGG - Intronic
1085640067 11:78188096-78188118 GGCCCAGGGCTCTCCAGAGCGGG + Intronic
1085697155 11:78714763-78714785 GGCGGGGCACACTGCAGAGCAGG - Intronic
1090086487 11:123654695-123654717 GGCCCAGCGCCGCGCCGAGCGGG + Intronic
1091276994 11:134359355-134359377 GCCCGAGTGCCCAGCAGGGCAGG - Intronic
1091848855 12:3679021-3679043 GGCCCAGCGCCATGAAGAGAAGG - Exonic
1093150739 12:15618186-15618208 AGGAGAGCGCCCTGTAGAGCTGG - Intergenic
1096123349 12:49102832-49102854 GGGTGAGCTTCCTGCAGAGCTGG - Intronic
1096183765 12:49565435-49565457 TGCCAAGAGCCCTGCAGAGCAGG - Intronic
1097227986 12:57490210-57490232 AGCTGAGTGCCCTGCACAGCTGG + Exonic
1101493969 12:105236182-105236204 GGCCCAGCCCCCGGCCGAGCCGG + Intronic
1102028576 12:109727221-109727243 GGCCGGGCGGCCAGCAGAGTGGG + Intronic
1105954580 13:25268719-25268741 GGTTGCGCGCTCTGCAGAGCAGG + Intronic
1107836692 13:44417503-44417525 GGCTGAGAGCCCTGCAGAAATGG - Intergenic
1113877781 13:113605564-113605586 GGCCTTGAGGCCTGCAGAGCTGG - Intronic
1117326552 14:54674162-54674184 GGCCTAGGTCCCTGCAGAGTCGG + Intronic
1121314328 14:92952123-92952145 AGCCCAGGGCTCTGCAGAGCCGG - Intronic
1121695862 14:95911358-95911380 GGCCCAGGGCACTGCAGAGAGGG - Intergenic
1122237816 14:100342468-100342490 GTCTGGGCGCCCTGCAGGGCTGG + Exonic
1122939235 14:104973845-104973867 GTCCGAGTGCGCAGCAGAGCTGG + Intronic
1125361850 15:38872946-38872968 GGAGGAGGGCCCTGCAGAGCTGG + Intergenic
1126137204 15:45403231-45403253 GGCCGGGAACCCTGCAGCGCCGG - Exonic
1132572845 16:651521-651543 GGCTGTGGGTCCTGCAGAGCCGG + Intronic
1132683767 16:1153902-1153924 GGCCGAGCGCGGCGCGGAGCTGG + Exonic
1132699656 16:1216856-1216878 CGCCGAGTGCCCTGCAGGGTGGG + Intronic
1133249981 16:4474479-4474501 GGCCGAGTCCACTGCAGAGGCGG + Exonic
1136408586 16:30063986-30064008 GGCCTGGCTCCCTGCAGGGCAGG + Exonic
1136685806 16:31994363-31994385 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136786419 16:32937896-32937918 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136883353 16:33915899-33915921 GGCCGAGGGCCCTGCTGGGAGGG + Intergenic
1137288855 16:47037992-47038014 GGCCGAGCTCCCCGCGGGGCGGG + Intergenic
1138505664 16:57477098-57477120 GGCCGAGAGCACAGCAGAGGAGG + Intronic
1140187535 16:72788286-72788308 TCCCTGGCGCCCTGCAGAGCGGG - Exonic
1140504706 16:75464203-75464225 GGCCGAGCGCCCTCCAGCCCCGG + Intronic
1140512256 16:75516993-75517015 GGCCGAGCGCCCTCCAGCCCCGG + Intergenic
1140529036 16:75648236-75648258 GGCCGAGGGCGCCGCGGAGCCGG + Exonic
1141989441 16:87602131-87602153 GGCGGTGAGGCCTGCAGAGCAGG - Intronic
1142317031 16:89354041-89354063 TCCCGAGAGCCCTGCAGGGCTGG - Intronic
1203088653 16_KI270728v1_random:1199562-1199584 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1143768123 17:9150868-9150890 GGCCGGGTGCCCGGCACAGCGGG + Intronic
1145797863 17:27666407-27666429 CTCCCAGCGCCCTGCAAAGCAGG - Intergenic
1145812311 17:27771743-27771765 CTCCCAGCGCCCTGCAAAGCAGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147159813 17:38563257-38563279 GGTCCAGCACCCTGCAGAGGAGG + Intronic
1148115040 17:45170491-45170513 GGCCCAACCCCCTGCAGAGAGGG - Intergenic
1148201774 17:45754061-45754083 GAATGAGGGCCCTGCAGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151491328 17:74433532-74433554 GCCTGAGCGCCCTGCACAGAGGG + Intronic
1151731624 17:75914797-75914819 GGCCGAGCGCGAGGCCGAGCGGG - Exonic
1151945782 17:77319250-77319272 GGCCAAGGGCTCAGCAGAGCAGG - Intronic
1152430104 17:80244098-80244120 GGCCGAGCCGCCTTGAGAGCAGG + Intronic
1152925239 17:83084668-83084690 GGCCGAGCTCCCGGGAGTGCAGG - Intronic
1155427740 18:25723968-25723990 AGCAGAGCTCCCTGCAGAGAGGG + Intergenic
1157324035 18:46656536-46656558 GGCAGAGCGCCCTGAACTGCTGG - Intronic
1160115570 18:76075904-76075926 GGCTGAGCTTACTGCAGAGCTGG - Intergenic
1160231722 18:77054058-77054080 GGCCAAGCACCCTGCAGACCAGG - Intronic
1160500366 18:79398637-79398659 GGCCGCGGGCCCTGCAGGGATGG - Intronic
1160858464 19:1227710-1227732 TCCGGAGCGCCCTGCAGGGCCGG + Exonic
1161114272 19:2488197-2488219 GGCCCAGCGTCCTGGGGAGCAGG - Intergenic
1162033027 19:7925548-7925570 CGCCGCGCGCCCTGCGGAGGAGG + Exonic
1162194702 19:8975559-8975581 GGCCAAAGTCCCTGCAGAGCTGG + Exonic
1163464071 19:17455949-17455971 GCCCGAGGTCCCTGCGGAGCGGG + Exonic
1164624027 19:29714990-29715012 GGCCGGGCTCCCGGCAGGGCGGG + Exonic
1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG + Intronic
1167521430 19:49958392-49958414 GGCCCAGGGCCCGGCTGAGCTGG + Exonic
1167523944 19:49972327-49972349 GGCCCAGGGCCCGGCTGAGCTGG - Intergenic
1167756119 19:51414930-51414952 GGCCCAGGGCCCGGCTGAGCTGG + Exonic
1167784704 19:51627568-51627590 GGCCCAGGGCCCAGCTGAGCTGG + Exonic
926801795 2:16665794-16665816 GGCGGAGCGGGCGGCAGAGCAGG - Exonic
927146208 2:20168207-20168229 GGCCCAGCGCCCTGCAGCAGAGG - Intergenic
927186812 2:20487999-20488021 GGCCAGGGGCCCAGCAGAGCTGG + Intergenic
932073998 2:68646199-68646221 GGCCGTGCTCCCAGGAGAGCTGG - Exonic
932331635 2:70901289-70901311 CCCCGGCCGCCCTGCAGAGCCGG - Intronic
932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG + Intronic
932791037 2:74654580-74654602 GGCCGAGCGGTCTGAGGAGCAGG - Intronic
932863225 2:75316177-75316199 TGCAGAGGGCACTGCAGAGCAGG + Intergenic
935301683 2:101698203-101698225 GCCCGAGCGCCCGGCCGACCTGG - Intronic
936509528 2:113133836-113133858 GGCTGGGAGCTCTGCAGAGCAGG + Exonic
937298177 2:120822305-120822327 GGCATAGTGCCCTGCACAGCGGG + Intronic
937883673 2:126886262-126886284 GGCTGAGCGCCCTCCAGCACCGG + Intergenic
938082617 2:128378308-128378330 GGCCGGGAGACCTGCAGAGGAGG - Intergenic
938203911 2:129400998-129401020 GGCAGAGCAGCCTGCACAGCAGG - Intergenic
938688900 2:133768460-133768482 GGCAGAGCGCCCAGCTGAGGAGG + Intergenic
944271206 2:197786317-197786339 GGCAGAGCGCACGGCACAGCGGG + Exonic
946163293 2:217848726-217848748 AGCCGAGCCCCCTGCTGGGCGGG + Exonic
946175222 2:217918445-217918467 GGCAGAGCCCCCTGCACAGGCGG + Intronic
946333000 2:219021051-219021073 TGCCGAGCGTCAGGCAGAGCTGG - Intronic
946607354 2:221420254-221420276 GGGCAAGGGCTCTGCAGAGCTGG + Exonic
947765307 2:232633865-232633887 AGCTGAGCGCCCAGCTGAGCCGG + Exonic
948140489 2:235669536-235669558 GGCCGCGCGCCCAGCCGGGCTGG - Intronic
948468049 2:238161560-238161582 GGCCAACCGCCCTGCTGGGCTGG + Intronic
1169141631 20:3230144-3230166 GGCTGAGCGCCCTGTTCAGCAGG + Intronic
1169569017 20:6886682-6886704 GGAAAAGCGCACTGCAGAGCAGG - Intergenic
1171484589 20:25477690-25477712 GATCGGGAGCCCTGCAGAGCGGG + Intronic
1172178403 20:32986316-32986338 GGTCCAGGGCCATGCAGAGCTGG + Intronic
1172838182 20:37886398-37886420 GGCTGAGGGCACTGCAGGGCAGG - Intergenic
1173003357 20:39121551-39121573 GACCGCACGCCCTGCAGAACTGG + Intergenic
1174110491 20:48194800-48194822 GTCTGCGCGCCCTGCAGGGCTGG - Intergenic
1175252147 20:57616259-57616281 AGGCGAGGGTCCTGCAGAGCTGG - Exonic
1175909459 20:62397840-62397862 GGCCAACAGCCCTGCAGGGCAGG - Intronic
1175967486 20:62666714-62666736 TGCCGGGTGCCCTGCTGAGCGGG - Intronic
1177821217 21:26032878-26032900 GGCTCAGAGCCCTGCAGAGATGG + Intronic
1178104101 21:29299184-29299206 GGCCGAACCCCCTGCACTGCCGG + Intronic
1179491165 21:41742409-41742431 GGCCTAGCAGCCTGCAGAGATGG + Intronic
1180062070 21:45390683-45390705 GGCCGGGTGTCCTGCAGGGCTGG + Intergenic
1180137576 21:45871343-45871365 AGCCCAGTGCCCTGGAGAGCTGG + Intronic
1180252044 21:46596407-46596429 GGCCTGGGGCCCTGCAGAGGTGG + Intergenic
1180834111 22:18921293-18921315 AGCGCAGCGCCCTGCTGAGCTGG + Intronic
1180871747 22:19150446-19150468 GGCCGGGGGCGCTGCAGAGAGGG + Intergenic
1181065710 22:20304944-20304966 AGCGCAGCGCCCTGCTGAGCTGG - Intergenic
1181130280 22:20727204-20727226 AGCCCAGGGCCCTGCTGAGCTGG - Intronic
1182586603 22:31347071-31347093 GGCTGCGCGCCCGGAAGAGCTGG + Intergenic
1182958866 22:34453299-34453321 GTCCCAGTGCCCTGCAGAGCAGG + Intergenic
1184033753 22:41909172-41909194 GGCCAAGCGACCTGCAGGCCAGG + Intergenic
1184245884 22:43235528-43235550 GGCCCAGAGCACTGCAGAGGGGG + Intronic
1184383906 22:44163575-44163597 GGCCGTGAGCCCTCGAGAGCAGG + Intronic
1184759495 22:46536774-46536796 AGCAGAGCGCCCCGCAGAGCCGG + Exonic
1184879416 22:47295523-47295545 GCCCGAGCGCCTGGAAGAGCGGG + Intergenic
1203284199 22_KI270734v1_random:146591-146613 AGCGCAGCGCCCTGCTGAGCTGG + Intergenic
951679693 3:25281938-25281960 AGCCCAGGGCCTTGCAGAGCAGG - Intronic
952382717 3:32817407-32817429 GGCCCACCGCCCTGCAGGGGAGG + Intergenic
953697037 3:45167740-45167762 AGCCGGGAGCCCTGCAGCGCCGG + Intergenic
953851713 3:46469981-46470003 GGCAGAGGGTCCTGCAGAGGAGG - Intronic
954415050 3:50389178-50389200 GGCCGAGCACCCTGCAGCTTGGG - Intronic
961832703 3:129632347-129632369 AGCCCAAGGCCCTGCAGAGCCGG - Intergenic
962317370 3:134367284-134367306 AGCCGAGAGGCCGGCAGAGCAGG - Intronic
963746485 3:149129672-149129694 CTCCGGGCGCCCTGCAGGGCGGG + Exonic
968235987 3:197030185-197030207 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236014 3:197030269-197030291 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236041 3:197030353-197030375 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236068 3:197030437-197030459 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968659515 4:1793338-1793360 GTCCGTGCGACCGGCAGAGCAGG - Exonic
968865983 4:3212087-3212109 GCCCGAGCTGCCTGCAGAGCCGG + Exonic
968965115 4:3765823-3765845 GGCCGCGGGCCCTGGGGAGCTGG - Intergenic
969138812 4:5051709-5051731 GGCCGAGCACCGTGCAGGGGCGG - Exonic
969437693 4:7198212-7198234 GACAGAGAGGCCTGCAGAGCCGG - Intronic
985576068 5:674073-674095 GGCCGTCAGCCCTGCAGGGCCGG - Intronic
985726290 5:1517499-1517521 GGCAGAGCGCCCTTGAGTGCTGG - Intronic
985728142 5:1526362-1526384 GGCCAAGGGCTGTGCAGAGCAGG + Intergenic
985749994 5:1668177-1668199 TGCAGAGCGCCCTGCAGACAGGG - Intergenic
996559034 5:124808877-124808899 GGGCCAGCGCCCTGCACAGCCGG - Intergenic
997595913 5:135107418-135107440 GGCCCAACCCACTGCAGAGCAGG - Intronic
998004748 5:138649485-138649507 GGACAAGGGCGCTGCAGAGCCGG + Intronic
998814614 5:146000246-146000268 TGTAGAGGGCCCTGCAGAGCGGG - Exonic
1006746489 6:36346431-36346453 GGTCCTGCTCCCTGCAGAGCAGG - Intergenic
1007264577 6:40586983-40587005 GCCCGGGCGCCCCGCGGAGCCGG - Exonic
1019263043 7:93061-93083 GTACGAGCACCCTGCAGAGCGGG + Intergenic
1019522138 7:1465855-1465877 GGCCCAGGGGCCTCCAGAGCTGG - Intergenic
1021450302 7:20778143-20778165 CGCTGAGCGCGCTGCAGAACGGG + Intergenic
1022923240 7:35037142-35037164 GGCCCAGCGCCCAGCGCAGCCGG + Intronic
1024695111 7:51847857-51847879 GGTCGAGCATCCTGCAAAGCAGG + Intergenic
1029577445 7:101412736-101412758 GGTCCTGCTCCCTGCAGAGCAGG - Intronic
1035171900 7:157021656-157021678 CGCCGAGCGCCACGCTGAGCTGG - Intergenic
1035710086 8:1706438-1706460 GGCAGCGTGCCCTGCAGAGCTGG - Exonic
1036681577 8:10878241-10878263 GGCCAAGAGCCCTGCAGGGCTGG - Intergenic
1037951429 8:23020820-23020842 GGCTGAGCGTCCTGCACAGAAGG + Exonic
1039902065 8:41759967-41759989 GACCGAGCTGGCTGCAGAGCTGG - Intronic
1044731050 8:95229001-95229023 GGGCGTGGGGCCTGCAGAGCAGG + Intergenic
1045215646 8:100145885-100145907 GGGCGGGAGCGCTGCAGAGCCGG - Intergenic
1045510863 8:102810884-102810906 CGCCGAGCGCCCGGCAGGGGCGG - Intergenic
1047492558 8:125386794-125386816 CCCCGAGAGCCCTGCAGAGCTGG - Intergenic
1048318918 8:133383465-133383487 GGCCCAGGGCTCTGCAGGGCTGG + Intergenic
1049554733 8:143276147-143276169 GCCCGAGCGGGCTGCCGAGCTGG + Exonic
1049807918 8:144549265-144549287 GGTCCAGCGCCCTGCACAGCAGG - Intronic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1053618179 9:39791444-39791466 GGCCGGGCGCCCTGCCAGGCCGG - Intergenic
1053876353 9:42550814-42550836 GGCCGGGCGCCCTGCCAGGCCGG - Intergenic
1053896318 9:42743888-42743910 GGCCGGGCGCCCTGCCAGGCCGG + Intergenic
1054235344 9:62550907-62550929 GGCCGGGCGCCCTGCCAGGCCGG + Intergenic
1054265978 9:62915985-62916007 GGCCGGGCGCCCTGCCAGGCCGG + Intergenic
1056543199 9:87592156-87592178 GGCCTTGGACCCTGCAGAGCTGG - Intronic
1060835978 9:126755483-126755505 GGCCCAGGGCCCCACAGAGCAGG - Intergenic
1060852579 9:126889765-126889787 GCCAGAGCGCCCTGGAGAGCAGG - Intergenic
1060884280 9:127139603-127139625 GGCCCAGGGCCCTGCAAAGGAGG - Intronic
1062126368 9:134865112-134865134 GGCCAAATTCCCTGCAGAGCTGG - Intergenic
1062260415 9:135659906-135659928 GGCCAAGAGCCCTGCAGCACAGG + Intergenic
1062581380 9:137230651-137230673 GGCCGAGGGCACTGCGGGGCGGG - Intergenic
1191735551 X:64384724-64384746 GGCCGAAGGCCCTGCAGCCCTGG - Intronic
1201499523 Y:14627324-14627346 GGGAGTGGGCCCTGCAGAGCAGG + Intronic