ID: 1165159889

View in Genome Browser
Species Human (GRCh38)
Location 19:33809952-33809974
Sequence ATGGGGCAGGAGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1621
Summary {0: 1, 1: 0, 2: 19, 3: 204, 4: 1397}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165159883_1165159889 -7 Left 1165159883 19:33809936-33809958 CCTGAGGAGCCCTTGCATGGGGC 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG 0: 1
1: 0
2: 19
3: 204
4: 1397
1165159881_1165159889 -6 Left 1165159881 19:33809935-33809957 CCCTGAGGAGCCCTTGCATGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG 0: 1
1: 0
2: 19
3: 204
4: 1397
1165159877_1165159889 6 Left 1165159877 19:33809923-33809945 CCCAGGATAGAGCCCTGAGGAGC No data
Right 1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG 0: 1
1: 0
2: 19
3: 204
4: 1397
1165159878_1165159889 5 Left 1165159878 19:33809924-33809946 CCAGGATAGAGCCCTGAGGAGCC 0: 1
1: 0
2: 3
3: 21
4: 176
Right 1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG 0: 1
1: 0
2: 19
3: 204
4: 1397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165159889 Original CRISPR ATGGGGCAGGAGAGGCAGGA TGG Intronic
900089285 1:912717-912739 ATAGTTCAGGAGGGGCAGGAGGG - Intergenic
900094004 1:933028-933050 CTGGGGCAGGAGGCGCAGGAAGG - Intronic
900106555 1:983934-983956 TTGGGACAGGAGAGGCAGGGAGG + Intergenic
900115291 1:1025566-1025588 AGGGGGCAGGAGAGGGTGGCAGG - Intronic
900137903 1:1126204-1126226 ATGGCGCAGGACAGGCAGACCGG - Intergenic
900584283 1:3424960-3424982 AGAGGGCAGGAGACGCCGGAGGG + Intronic
900620995 1:3587911-3587933 AGGGGGCAGGAGAGGCCAGGAGG + Intronic
900621026 1:3587981-3588003 AGGGGGCAGGAGAGGCCAGGAGG + Intronic
900621214 1:3588431-3588453 AGGGGGCAGGAGAGGCCAGGAGG + Intronic
900640929 1:3687758-3687780 AGGCGCCAGGAGAGGCAGGAAGG - Intronic
900889824 1:5441737-5441759 GAAGGGCAGGAGACGCAGGAGGG - Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900956284 1:5888068-5888090 ATGGGGCACGAGAGGCCCGCCGG + Intronic
901105982 1:6756913-6756935 TTTGGGCAGCTGAGGCAGGAAGG + Intergenic
901174427 1:7288536-7288558 ATGGAAGAGGAGAGGCAGGCAGG + Intronic
901201419 1:7469506-7469528 ATGGGGCTGGAGGCCCAGGAAGG - Intronic
901516652 1:9751986-9752008 ATGGGACAAGACAGGCAGAAGGG + Intronic
901639999 1:10688320-10688342 ATGGGGCAAGAAAGGTAGCAGGG + Intronic
901651622 1:10746502-10746524 ATGGGGCTGGGAAGGCAGAAGGG - Intronic
901680364 1:10909555-10909577 ATGGGTCAGGAAATGAAGGAAGG - Intergenic
901680658 1:10910786-10910808 AGGGGGCAGGCGAGGAGGGAGGG + Intergenic
901715496 1:11150277-11150299 AAGGGGCAGGAGAGGAAGATTGG - Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901794506 1:11672668-11672690 AAGGGGCAGGGGAGGCAGGTAGG - Intronic
901857203 1:12052273-12052295 ATGAGGCCAGAGGGGCAGGACGG - Intergenic
902070079 1:13727037-13727059 CTGAGGCAGGAGGGGCAGGCAGG - Intronic
902074978 1:13777263-13777285 ATCCTCCAGGAGAGGCAGGATGG - Intronic
902122203 1:14175839-14175861 TTGGGGAAGGGAAGGCAGGATGG + Intergenic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902329427 1:15724050-15724072 ACAGGGCAGGAGAGGGAGCACGG - Intronic
902416770 1:16244368-16244390 CTGGGGAAGGAAAGGCAGGTAGG + Intergenic
902571475 1:17349811-17349833 ATGGTGCTGGAGAGGCAGGTGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903029122 1:20450261-20450283 AAGGTGCAGGAGGGGCAGGAGGG + Intergenic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903140779 1:21338040-21338062 AGGGGGCAGAAGGGGAAGGAAGG - Intronic
903206164 1:21783891-21783913 CTGGGGCAGGAGTCGCAGAAAGG - Intergenic
903339396 1:22644305-22644327 CTGGGGCAGGCGTGGCAGCAAGG - Intronic
903376620 1:22870452-22870474 GTGGGTGTGGAGAGGCAGGAGGG - Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903713969 1:25349105-25349127 ATGGGGCAGGAGAAGCAGTGTGG + Intronic
903848156 1:26290665-26290687 GTGGGGCTTGAGAGGAAGGAGGG + Intronic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904332215 1:29767467-29767489 ATGGGGCACGAGGGTGAGGAAGG - Intergenic
904339991 1:29828334-29828356 GTGGGGCAGGGAAGGCAGGTGGG + Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904563301 1:31413075-31413097 CTGGGGCAGGTGCGCCAGGAGGG - Intronic
904611649 1:31729115-31729137 GAGGGCCAGGAGAGGCATGAGGG - Intronic
904823210 1:33258134-33258156 GTAGGGCAGGAGTGGCAGAAAGG - Intronic
904877561 1:33668186-33668208 CTGGGCCAGGAGAGGTAGGCAGG + Intronic
904901342 1:33859672-33859694 AAGGGGCAGGAGGGGGATGAAGG + Intronic
904964280 1:34359615-34359637 ATGGGGCTGGAGAGGCAGTGAGG + Intergenic
904964548 1:34361298-34361320 ATGGGGAAAGAGAGCCAGGATGG + Intergenic
904993634 1:34614036-34614058 ATGAGGCGGGAGGGGCAGGCAGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905318421 1:37098268-37098290 ATTAGGGAAGAGAGGCAGGATGG - Intergenic
905401479 1:37706849-37706871 AAGTGGCAAGACAGGCAGGAAGG - Intronic
905475179 1:38221304-38221326 ATGGGCCAGGAGTGGAATGAAGG - Intergenic
905476125 1:38229408-38229430 ATGGAGTAGGAAAGGCAGGCAGG + Intergenic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
905638794 1:39574849-39574871 ATGCTGCAGGCGTGGCAGGAGGG - Intronic
905732576 1:40306707-40306729 ATATGGCAGGAGGGGCAGGTTGG + Intronic
905914457 1:41675229-41675251 ATGTGGCAGGAGGGGCAGGTGGG - Intronic
905942930 1:41878720-41878742 GGGGGGAAGGAGAGGAAGGAAGG - Intronic
906398633 1:45488872-45488894 ATAGGGCAGGCCAGGCATGATGG + Intronic
906518418 1:46453051-46453073 AGAGGGCAGGAGGGGCGGGAAGG - Intergenic
906743037 1:48201113-48201135 GAGGGGCAGGAGGGGCAGAAGGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906868485 1:49449496-49449518 ATAGGGCAGAGGAGGCAGGAAGG + Intronic
907114913 1:51959980-51960002 ATGGGGTTGGGGAGGCAGAAAGG + Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907216795 1:52870760-52870782 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
907310407 1:53535741-53535763 ATGGGTTGGGAAAGGCAGGAGGG - Intronic
907401243 1:54226191-54226213 GAGGGGCTGGAGAGGCAGGGAGG + Intronic
907403434 1:54239631-54239653 ATGGGGCAGGAGGGAGAGGCAGG + Intronic
907578885 1:55554234-55554256 GTGGGTGAGGAGAGGCAGGTTGG + Intergenic
907638342 1:56159074-56159096 ATAGAGCTGGATAGGCAGGAAGG + Intergenic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
907872679 1:58457198-58457220 GAGGGCCAGGAGAGGCAGGTTGG - Intronic
908042777 1:60133004-60133026 ATTGGGAAGCCGAGGCAGGAGGG - Intergenic
908513795 1:64871998-64872020 ACGAGGCTGGAGAGGCAGGTGGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908656866 1:66397430-66397452 ATGAGGTTGGAAAGGCAGGAAGG + Intergenic
908714659 1:67056239-67056261 ATGCGGTAGGAGAGGCACAAAGG - Intergenic
908858780 1:68459794-68459816 ATGGGGTAGAAGAAGCAGGGTGG + Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
910219490 1:84876199-84876221 ACGGGGTAGGAGAGGGAGGCAGG - Intronic
910227940 1:84955521-84955543 AGGGGTCTGGAGAGGCAGGCAGG + Intronic
910337797 1:86154775-86154797 TCGGGGCAGGAGCTGCAGGAGGG + Intronic
910610981 1:89141853-89141875 AAGAGGCTGGACAGGCAGGAGGG - Intronic
910614962 1:89187321-89187343 AGGAGGCTGGACAGGCAGGAGGG - Intronic
911000553 1:93160828-93160850 GGGGGGCAGGGGAGGCAGGGGGG - Intronic
911351032 1:96755824-96755846 GTGGGAAAGGACAGGCAGGAGGG + Intronic
911778840 1:101849576-101849598 ATGATGCAGGATAGGCAGGCAGG + Intronic
911828766 1:102523540-102523562 ATGGTCCAGGAGTGGCAGGATGG - Intergenic
911856495 1:102884164-102884186 ATGAGGGATGAGAGACAGGAGGG - Intronic
912799806 1:112713857-112713879 ATGGGGGAAGTGAGGCAGGCAGG - Intronic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
913200196 1:116489745-116489767 ATGGGCCAGGAAAGGGAGAAGGG + Intergenic
913566717 1:120080133-120080155 ATAGGGGAGGGGAGGCAGCAAGG - Intergenic
913631414 1:120713419-120713441 ATAGGGGAGGGGAGGCAGCAAGG + Intergenic
914287473 1:146240840-146240862 ATAGGGGAGGGGAGGCAGCAAGG - Intergenic
914548505 1:148691582-148691604 ATAGGGGAGGGGAGGCAGCAAGG - Intergenic
914618174 1:149380129-149380151 ATAGGGGAGGGGAGGCAGCAAGG + Intergenic
915087817 1:153399943-153399965 ACAAGGCTGGAGAGGCAGGAGGG + Intergenic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915244995 1:154550511-154550533 TTGGGGCAGGACAGGGAGGGTGG - Intronic
915283506 1:154838458-154838480 ATGGGGCTGTAGAGGCAGGCAGG - Intronic
915449329 1:155993830-155993852 CAGGGGCAGGAAGGGCAGGAAGG + Intronic
915465889 1:156097723-156097745 ATAGGGCAGGGCAGGCAGGGAGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915893572 1:159793565-159793587 CTAGGGCAGCAGCGGCAGGAGGG - Intergenic
915899064 1:159833470-159833492 ATGAGGTGGGAGAGGTAGGAAGG - Intronic
916314625 1:163435759-163435781 ATTGGGAAGGAGGGGTAGGAAGG - Intergenic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
916805202 1:168252939-168252961 ATGGGGGAGGAGAGACAGCTTGG - Exonic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917156301 1:172003527-172003549 AGGGGGCAGGAGAGGAGGGAGGG - Intronic
917159823 1:172044969-172044991 ATGAGACAGGAGAGGATGGAAGG + Intronic
917189591 1:172400430-172400452 AAGGGGCAGGAAAGGAGGGAAGG + Intronic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
917779400 1:178376088-178376110 ATGTGGGAGGAAAGCCAGGATGG + Intronic
917958605 1:180125219-180125241 ATGGGGCTGGAGAGGTGTGATGG + Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918368860 1:183838581-183838603 TGGAGGCAGGAGAGGCAGAAGGG - Intronic
918609036 1:186465425-186465447 GTGGGGCAAGAGAGACAGGAGGG + Intergenic
918862800 1:189854657-189854679 GTTGGGCAGGTGAGGGAGGAGGG - Intergenic
919422661 1:197390038-197390060 ATTGGGGAGGAGTGGCAGGTGGG + Intronic
919745163 1:201004293-201004315 AAGGGACAGGGGAGGCAGGGAGG - Intronic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
919829308 1:201529176-201529198 AGGGGGAAAGAGAGGCGGGAGGG - Intergenic
919847535 1:201650971-201650993 ATGGGGCAAGAGAGACAATAAGG + Intronic
919960180 1:202459301-202459323 ATGGGGCAGAGGGAGCAGGAGGG + Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920086069 1:203418246-203418268 ATGAGGCTGGGGAGGCAGGCAGG + Intergenic
920507158 1:206524725-206524747 ATGGGGCAGAAGAGATGGGAAGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920735688 1:208531290-208531312 ATCTGGAAGGAGCGGCAGGATGG + Intergenic
920750016 1:208665227-208665249 ATTGAACAGGAGAGGCAGGTGGG - Intergenic
920784752 1:209030442-209030464 ATGTGCCAGGAGAGGCATGAGGG - Intergenic
920979782 1:210822325-210822347 ATGAGGATGGAGAGGCAGGCAGG + Intronic
921280049 1:213557466-213557488 AGAGGGAAGAAGAGGCAGGATGG + Intergenic
921334981 1:214076811-214076833 GTGGAGGAGGAGGGGCAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921650399 1:217671617-217671639 AGAGGACAGGAGAGGCAGGGAGG - Intronic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
923139855 1:231151900-231151922 ATGGAGCTGGAGTGGCAGGGAGG + Intergenic
923167804 1:231383668-231383690 ATGGGGCAGGACAGACAGGCAGG + Intronic
923284121 1:232475196-232475218 ATGAGGTCGGAGAGGTAGGAAGG - Intronic
923498422 1:234544532-234544554 AGGGTGCAGGAGAGGGAGGGAGG + Intergenic
923707482 1:236356255-236356277 ATGGAGCAGGGGAGGAAGGGAGG + Intronic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
923857657 1:237862417-237862439 ATGAGGCTGGAGAGCCAGGCTGG + Intergenic
924457468 1:244230134-244230156 ATGGGGCAGGAGGGGGAGGTAGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924669040 1:246104570-246104592 ATGGGGCAAGAGCTGCAGGCTGG + Intronic
924745696 1:246831692-246831714 ATGGGCAAGGAAAGACAGGAAGG + Intergenic
1062902795 10:1158437-1158459 AGAGGGGAGGAGAGGAAGGAAGG - Intergenic
1062920068 10:1272933-1272955 TGGAGCCAGGAGAGGCAGGAAGG - Intronic
1063121818 10:3109887-3109909 ATGGGGCAGAGGGGGCAGGGAGG + Intronic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1063595057 10:7427529-7427551 CTAGGGCAGCTGAGGCAGGAGGG - Intergenic
1063670479 10:8095863-8095885 TCGGGGCAGGAGAGGCAGCCAGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1063958748 10:11288586-11288608 ATGCAGCAGGAGTGGCAGGTAGG + Intronic
1064010383 10:11730658-11730680 ATGGGGTAAGGGAGGCAGCAGGG - Intergenic
1064134711 10:12740628-12740650 ATGGAGCTGGAAAGGCAGGTAGG + Intronic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064778836 10:18810723-18810745 ATGGGAGCGGAGAGGAAGGATGG - Intergenic
1064807129 10:19147973-19147995 ATGAAACAGGAGAGGAAGGAAGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065866589 10:29920024-29920046 AGGGGGCAGGAGAGGCAGGCAGG - Intergenic
1066242370 10:33550826-33550848 AGGGGGAAGGAGGGGCTGGAAGG - Intergenic
1066523815 10:36253385-36253407 ATGGGGAAGTAGTGTCAGGAAGG - Intergenic
1067108931 10:43384910-43384932 ATGGGGAAGGAGAGGCCTGTAGG - Intergenic
1067162912 10:43842379-43842401 ATGGGGCTGGAGGAGTAGGAGGG + Intergenic
1067278994 10:44857297-44857319 ATGGGGTAGGTGAGGGAGGTGGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067342661 10:45418066-45418088 CTGGGCCAGGAGGGGCAGAAGGG - Intronic
1067509479 10:46883265-46883287 ATGGAGCAGGAATGGCAGGTAGG + Intergenic
1067774945 10:49156682-49156704 ATGGGGCAGCAACAGCAGGAAGG + Intronic
1067796857 10:49327145-49327167 GTGGGCCAGGAGAGGGAGGAAGG - Exonic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069628323 10:69881596-69881618 CAGGGGCAGGAGAGCCAGGCTGG + Intronic
1069705912 10:70458923-70458945 CGTGGGCAGGAGAGTCAGGATGG + Intergenic
1069784199 10:70977505-70977527 GTGGGGAAGGAGAAGCAGGTGGG + Intergenic
1069802451 10:71090521-71090543 GTGGGGCTGGAAAGGCAGGCAGG + Intergenic
1069884106 10:71612677-71612699 TTGGGGCAGGAGTGGGAGGCCGG + Intronic
1069891143 10:71653143-71653165 ATGTGGCAGGAGAGGGAGGCTGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070698649 10:78582584-78582606 AGGAGGCAGGAGAGGGATGAGGG + Intergenic
1070704699 10:78629218-78629240 AGAAGGCAGGAGGGGCAGGAGGG - Intergenic
1070721946 10:78763046-78763068 ATGGGGTTGGTGAGGCAGGCTGG - Intergenic
1070984707 10:80678717-80678739 AAGGGGAAAGAGTGGCAGGAGGG + Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071346473 10:84698685-84698707 AGGATGCAGAAGAGGCAGGAGGG + Intergenic
1071481433 10:86067874-86067896 ATGGGGCAGGGGAGGAAGCTTGG - Intronic
1071482939 10:86078724-86078746 AGGGCTCGGGAGAGGCAGGAAGG + Intronic
1071858215 10:89646670-89646692 ATGAGGCAGGAGAGGTAGGGAGG - Intergenic
1072050574 10:91699396-91699418 ATGGGGCAGGGGAGAGAGGGAGG - Intergenic
1072232398 10:93424769-93424791 ACTGGGCAGGACAGGCAGGGAGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072761618 10:98061467-98061489 AGTGGGGAGGAGATGCAGGAAGG - Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1073034875 10:100557009-100557031 CTGGGGCAGGAAAAGCAAGATGG + Exonic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073096523 10:100983564-100983586 CTGGGGCAGGAGTGGCTGGCCGG - Exonic
1073103769 10:101020738-101020760 ATGGGGCGGGGGTGACAGGATGG + Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1073325935 10:102644043-102644065 ACGGGGCGGGAGGGGCAGGCCGG - Intergenic
1073477515 10:103763944-103763966 ATGGGGCAGAAGAGGAAGTGAGG - Intronic
1073485995 10:103819559-103819581 TGGGGGCAGAAGAGGGAGGAGGG + Intronic
1073512939 10:104053670-104053692 ATGGGAAAGGAGAGCCTGGAGGG - Intronic
1073598121 10:104819835-104819857 AGGAGGGTGGAGAGGCAGGAGGG + Intronic
1074028176 10:109658336-109658358 GTGGGGTGGGAGAGGCGGGAGGG + Intergenic
1074197874 10:111205287-111205309 AAGGGGAAGGAGAGCCAGCATGG - Intergenic
1074620232 10:115111524-115111546 ATATGGCAGGAGAGGAAGCAAGG + Intronic
1074780412 10:116798195-116798217 AGGGAGCAGGGGTGGCAGGAGGG + Intergenic
1075102644 10:119517144-119517166 CTGGGGCATGAAAGGAAGGAAGG + Intronic
1075388821 10:122077548-122077570 ATGAGGCAGGAGAGGGAGGTTGG + Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075742656 10:124705285-124705307 GTGGGGCTAGAGGGGCAGGAGGG + Intronic
1076307300 10:129474292-129474314 TTGGGGCAGAGGATGCAGGATGG + Intronic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076352944 10:129831313-129831335 ATGGTGCAGGAGTGGGAGGGAGG - Intergenic
1076587847 10:131561356-131561378 AAGGAGCAGGAGAGGCTGGCAGG - Intergenic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076869306 10:133185763-133185785 GTGGGGCAGGAGAGGAAGGCGGG + Intronic
1076916144 10:133423898-133423920 AAGTGGCAGGTGGGGCAGGAGGG + Intronic
1076936248 10:133568684-133568706 AAGTGGCAGGTGGGGCAGGAGGG + Intronic
1076936252 10:133568693-133568715 GTGGGGCAGGAGGGGCAGGAGGG + Intronic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077076279 11:703623-703645 GTCGGGCTGGAGACGCAGGATGG + Intronic
1077131210 11:973677-973699 CTGGTGCAGGAGAGGGAGGGTGG + Intronic
1077155224 11:1088135-1088157 AGGGGGCAGGGCAGGCAGGGAGG - Intergenic
1077393308 11:2309569-2309591 GTGGGGCAGGAGAGCCTGGCAGG + Intronic
1077407098 11:2387554-2387576 ACAGTGCAGGAGAGGCAGGAAGG - Intronic
1077424040 11:2466176-2466198 TTGGGGGAGGAGATGCAGGCAGG + Intronic
1077497330 11:2892557-2892579 ATGGGGGAGGGGCGGCAGGGCGG - Intronic
1077522371 11:3043848-3043870 ATGGGGCAGGAGACGGAGAGAGG + Intronic
1077532463 11:3103651-3103673 AGGGGGCAACAGAGGCAGGAAGG - Intronic
1077532481 11:3103710-3103732 AAGGGGCAGCAGAGCCTGGAAGG - Intronic
1077532498 11:3103787-3103809 AGAGGGCTGCAGAGGCAGGAAGG - Intronic
1077532508 11:3103827-3103849 AAGGGGCTGCAGAGGCTGGAAGG - Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077535644 11:3122695-3122717 ATGGGGCAGGGTGGTCAGGAAGG + Intronic
1077908587 11:6555174-6555196 ATGAGGGAGGAGAGGAGGGATGG - Intronic
1078011467 11:7576115-7576137 ATGCGGCATGAGGGGCATGAAGG + Intronic
1078034901 11:7793645-7793667 TTGGAGCAGGAGAGTCATGATGG + Intergenic
1078064159 11:8067019-8067041 CTGGAGCGGGAGGGGCAGGATGG - Intronic
1078101289 11:8331834-8331856 GGGGGGCAGCAGAGGCTGGAGGG + Intergenic
1078116099 11:8452537-8452559 TTGGGAAAGGAGAGGCTGGAGGG + Intronic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1080358959 11:31490721-31490743 TTTGGGTAGGGGAGGCAGGAAGG - Intronic
1080442511 11:32308032-32308054 ATGGGCAAGGAGAGGCTGGCGGG + Intergenic
1080453690 11:32399687-32399709 ATGGAGCAGTAAAGGCAGAAAGG + Intronic
1080580374 11:33637471-33637493 ATGGGGCTGGAGAGGAAGGCAGG - Intronic
1080663453 11:34315600-34315622 TTGGGGCAGGGGAGGAGGGATGG - Intronic
1080747941 11:35125967-35125989 ATGGGGCAGGACAGGGCAGAGGG + Intergenic
1081503214 11:43687676-43687698 ATGGAACTGGAGAGGCAAGAAGG + Intronic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081666227 11:44918579-44918601 ATGGGGCAGGAGACACAAAATGG + Intronic
1081784036 11:45733755-45733777 ATGGAGCTGGAGATGCAGGCAGG - Intergenic
1082116810 11:48337763-48337785 AAGGGGCTGGAGTGCCAGGATGG + Intergenic
1082194380 11:49284500-49284522 AAGGGGAAGGAGGGGAAGGAAGG - Intergenic
1082256984 11:50042547-50042569 AAGGGGCTGGAGTGCCAGGATGG - Intergenic
1082687423 11:56258236-56258258 ATGGGGGAGGAGGGGGATGAAGG + Intergenic
1082783373 11:57303261-57303283 ATGAGTCCGGAGAGGCAGGTGGG - Intronic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083224117 11:61273907-61273929 GTGGGGCAGGAGAGGAAGCAGGG - Intronic
1083258970 11:61513037-61513059 AGGGGGCAGGGGAGACTGGAAGG + Intergenic
1083398121 11:62405227-62405249 ATGAGGCTGGAGAGACAGGTGGG + Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083543023 11:63527897-63527919 ATGGGGTAAGACATGCAGGAAGG - Intergenic
1083617614 11:64034494-64034516 GTGAGGAGGGAGAGGCAGGAAGG + Intronic
1083743438 11:64722871-64722893 AGGGGGCGAGGGAGGCAGGACGG - Intronic
1083860739 11:65418672-65418694 AGGAGGCAGGAGAGGGAAGAAGG - Intergenic
1083995090 11:66267709-66267731 TGGGGGGAGGCGAGGCAGGATGG - Exonic
1084065242 11:66700440-66700462 AAGGAGCAGGATGGGCAGGAAGG - Intronic
1084476930 11:69394483-69394505 ATCGGGAAGGAGAGGCTGGCAGG + Intergenic
1084501132 11:69536099-69536121 ATGGGGCATGATGGGCATGAGGG - Intergenic
1084576310 11:69990151-69990173 AGGGGTTAGGAGAGGCAGGGCGG - Intergenic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1084640402 11:70422682-70422704 GAGGGGCAGGAGGGGCAGGAGGG - Intronic
1084938397 11:72599482-72599504 ATGGGGGAGGTGAGGAAAGAAGG - Intronic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085038928 11:73315659-73315681 ATGAGGGAGGACAGGCAGAAGGG + Intronic
1085044268 11:73344125-73344147 ATGGGGCTGGTGAGGGATGAGGG + Intronic
1085052893 11:73388888-73388910 ACGGGGCAGCACAGGCAGGAAGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085361315 11:75890112-75890134 ATGGGGCTGGAGAGCTAGGCAGG + Intronic
1085410781 11:76289146-76289168 AAGGGGAAGAGGAGGCAGGAAGG + Intergenic
1086003444 11:82007403-82007425 ATGGGAGAGGGGAGGCAGAAGGG - Intergenic
1086290313 11:85301260-85301282 ATAAGGCTGGAGAGGCAGGCAGG + Intronic
1086497330 11:87418111-87418133 ATGGGGCAGGGGAGGCAAGAAGG + Intergenic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1088548611 11:110987419-110987441 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1088731478 11:112687667-112687689 ACAGGGCAGGAGGGGCGGGAGGG + Intergenic
1088820128 11:113449403-113449425 ATTGGGCAGGTGAGACAGGAAGG + Intronic
1088946611 11:114519634-114519656 AGGTGGAAGGAGGGGCAGGAGGG + Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089018003 11:115182774-115182796 ATGGGACACGACAGGCAGGGAGG - Intronic
1089149531 11:116354142-116354164 AGGAGGCAGGAGAGGATGGAAGG - Intergenic
1089360211 11:117880593-117880615 ATGAAGCAGGAGAGGCAGGTGGG - Intergenic
1089365992 11:117921487-117921509 ATGGGGCAGCTGGGGCTGGATGG - Intronic
1089390115 11:118095867-118095889 AGTGGGCAGGACAGGCTGGAGGG + Intronic
1089533839 11:119149190-119149212 GCGGGGCAGGCGAGGCAGGAGGG - Exonic
1089686225 11:120148342-120148364 ATGAAACAGGAGTGGCAGGAAGG + Intronic
1089789393 11:120931854-120931876 ATGAGGCTGGAGAGGCAGGCAGG - Intronic
1089837548 11:121384250-121384272 ATGGGGTGGGGGAGGCGGGAGGG + Intergenic
1089929586 11:122296997-122297019 CTCAGGCAGGACAGGCAGGAAGG - Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1090070439 11:123539705-123539727 ATGAGGCTGGACAGTCAGGATGG - Intronic
1090137330 11:124210861-124210883 TTGTGGCAGGAGAGGCTGCAGGG - Intergenic
1090184083 11:124725016-124725038 AGAGGGGAGGAGAGGCAGCAGGG - Intergenic
1090613924 11:128497490-128497512 ATGGGGCAGGAGGTGGATGAAGG - Intronic
1090622832 11:128576691-128576713 AGGGGGCTGGAGAGGTGGGAGGG - Intronic
1091241170 11:134053404-134053426 AAAGGGAGGGAGAGGCAGGAAGG + Intergenic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1091310761 11:134573700-134573722 TGGGGGCAGAGGAGGCAGGAAGG + Intergenic
1091333449 11:134749238-134749260 ATGAGGGAGGAGCTGCAGGAGGG - Intergenic
1091563097 12:1629550-1629572 AGGAGGCTGGAGAAGCAGGAGGG + Intronic
1091584587 12:1808899-1808921 ATGGGGCATGAAAGGGAGAAGGG + Intronic
1091933452 12:4415888-4415910 ATGGGGAAGGAAGAGCAGGAAGG + Intergenic
1092019998 12:5193729-5193751 CTGGGGCGAGAGAAGCAGGAGGG + Intergenic
1092048795 12:5453357-5453379 TTAGGGAAGGGGAGGCAGGAGGG - Intronic
1092135904 12:6146845-6146867 ACAGGGCTGGAGAGGTAGGAAGG + Intergenic
1092261800 12:6956835-6956857 ATGGGGCAGGGAGGACAGGAGGG - Intronic
1092540647 12:9418107-9418129 ATGGGGCAGGATAGAGAGCAGGG + Intergenic
1093203730 12:16221710-16221732 ATGGGGCAGGAGAGGAAGCAGGG + Intronic
1094008193 12:25778717-25778739 ATAGGGCAGAAGGGGGAGGATGG - Intergenic
1094041703 12:26126064-26126086 ATGTGGCAGCAGCGGCAGGTCGG - Intronic
1094052726 12:26238729-26238751 ATGGGACAGGAAATGAAGGAGGG - Intronic
1095826949 12:46540070-46540092 TGGGGTCAGGGGAGGCAGGAGGG - Intergenic
1096075321 12:48800367-48800389 AGGATGCAGGAGAGGCAGGGTGG + Intergenic
1096098788 12:48956668-48956690 AGGAGGCAGGAGAAGGAGGAGGG - Intronic
1096491885 12:52017194-52017216 ATGGTGCAGGACAGGTAGGGAGG - Intergenic
1096514452 12:52148371-52148393 ATGGGGCAGGAGAGGCAGCTTGG + Intergenic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1097098651 12:56570415-56570437 AGTGGGCTGGGGAGGCAGGAGGG + Intronic
1097119652 12:56721370-56721392 GTGGGGCAGGAGAGCAAGGAGGG + Exonic
1097145842 12:56938949-56938971 CTGGGGCAGGAGAAGAAGGGAGG - Intergenic
1097151403 12:56982487-56982509 CTGGGGCAGGAGAAGAAGGGAGG - Intergenic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098123992 12:67270364-67270386 AAGGGGGAGGGGAGCCAGGATGG + Intronic
1098595623 12:72271605-72271627 AGGAGGCAGGAAAGGCGGGAGGG - Intronic
1100129601 12:91475101-91475123 ATGGGGCAGCAGACCCATGAGGG - Intergenic
1100454857 12:94742061-94742083 AAGGACCAGGAGTGGCAGGAAGG + Intergenic
1101252474 12:102949765-102949787 TTGGGGTGGGAGATGCAGGAAGG + Intronic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101428581 12:104607730-104607752 AGGGGGCAGGAGTGGCAGGTTGG + Intronic
1101529725 12:105562986-105563008 ATGGGGCAGGGGGGGCAGTGAGG + Intergenic
1101580237 12:106036305-106036327 ATGGGGTGGGAGAGAAAGGAGGG + Intergenic
1101647338 12:106643373-106643395 ATGAGGTGGGAGAGGCAGGCAGG + Intronic
1101952423 12:109187085-109187107 AAGGGGTAGGAAAGGAAGGAGGG + Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102580126 12:113881103-113881125 ATGGGTCTGAGGAGGCAGGAGGG + Intronic
1102598773 12:114012992-114013014 AGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1102749251 12:115277852-115277874 ATGGGGCAGGTCTGGCTGGAGGG + Intergenic
1102900837 12:116635486-116635508 ATGGGGACGGGGAGGCAGGGCGG - Intergenic
1103327701 12:120132393-120132415 GAGGGGCGGGAGGGGCAGGAGGG + Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103485868 12:121282252-121282274 GTGGGGAAGGAGGGGCTGGAAGG + Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1104323524 12:127774217-127774239 AAGGGGCAGGAGATGGAGGGTGG - Intergenic
1104407093 12:128526873-128526895 ATGAGGCCAGAGAGGCAGGTGGG + Intronic
1104510242 12:129370863-129370885 ATGGGGCTGGAAAGGGAAGATGG + Intronic
1104576026 12:129966532-129966554 AGGGAGCAGGGAAGGCAGGAAGG + Intergenic
1104650038 12:130524871-130524893 TTGGGGCTGCAGAGGCAGGGAGG + Intronic
1104734709 12:131129625-131129647 AAGGGGCAGGAGTTGCAGAATGG + Intronic
1104789201 12:131471374-131471396 GTGGTGCAGGGGAGGCAGGACGG + Intergenic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1104900511 12:132187484-132187506 ATAGGCCAGGACAGCCAGGACGG - Intergenic
1104912222 12:132244791-132244813 ATGGGGCTGGACGGGCAGCATGG + Intronic
1105432176 13:20346339-20346361 CGAGGGCAGTAGAGGCAGGAAGG - Intergenic
1105483600 13:20803687-20803709 ATGAGGGTGGAGAGGCAGGGAGG - Intronic
1105705012 13:22963210-22963232 AAGGGGAAGGAGGGGAAGGAGGG + Intergenic
1105729046 13:23193247-23193269 ATGGAGCTGGAGAGGCTGGCTGG + Intronic
1105857969 13:24388388-24388410 AAGGGGAAGGAGGGGAAGGAGGG + Intergenic
1106017679 13:25884790-25884812 GTGGGGCAGGAGAAGCCGCAGGG - Intronic
1106293893 13:28392283-28392305 ATGTGCCAGAAGATGCAGGAGGG + Intronic
1106401669 13:29437020-29437042 GTGGGGAAGGAGTGGCTGGAAGG - Intronic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107405221 13:40105964-40105986 AGGGGGCTGGAGAAGCAGAAAGG + Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107972622 13:45658511-45658533 ATGGGGCAGGAGTGGGTGGCTGG + Intergenic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108287800 13:48925905-48925927 TTGGGGCATGAGCAGCAGGAAGG + Intergenic
1108503811 13:51091477-51091499 AAGGGGCAGGGAAGGCAGGCAGG - Intergenic
1108609672 13:52071737-52071759 ATGGAGCAGGAGAGGAGGGCTGG + Intronic
1109025274 13:57146853-57146875 ATAAGTCAGGAGAGGCAAGAAGG - Intronic
1109026264 13:57153426-57153448 ATAAGTCAGGAGAGGCAAGAAGG - Intronic
1109027256 13:57159997-57160019 ATAAGTCAGGAGAGGCAAGAAGG - Intergenic
1109028242 13:57166562-57166584 ATAAGTCAGGAGAGGCAAGAAGG - Intergenic
1109029229 13:57173133-57173155 ATAAGTCAGGAGAGGCAAGAAGG - Intergenic
1109177956 13:59178564-59178586 ATGGGGCAGAAGAGACAATAAGG - Intergenic
1111080661 13:83302434-83302456 ATGGGTCAGAAGAGACAGAAGGG - Intergenic
1111226984 13:85287718-85287740 GTGAGGCAGGAGAGAGAGGAGGG + Intergenic
1112094417 13:96116376-96116398 GTGGGGTGGGAGTGGCAGGAGGG + Intronic
1112388956 13:98965111-98965133 ATGAGGCCGGAGTGGCAGGTAGG + Intronic
1112872793 13:103995385-103995407 ATGGGGTAGGAGAAGCAGGGAGG - Intergenic
1113218377 13:108069862-108069884 AGGGTGCAGTAAAGGCAGGAAGG + Intergenic
1113539009 13:111092394-111092416 AGGGGGCAGGTGGGGCTGGAGGG - Intergenic
1113565566 13:111317760-111317782 CTGGGGTGGGAGGGGCAGGAGGG - Intronic
1113614530 13:111671155-111671177 ACAGGGCAGGGGAGACAGGAAGG + Intronic
1113619998 13:111756069-111756091 ACAGGGCAGGGGAGACAGGAAGG + Intergenic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114246464 14:20919269-20919291 TTGGGCCAGCAGAGCCAGGAGGG - Intergenic
1114444828 14:22780411-22780433 ATGGGGAATGGGAGGTAGGAGGG - Intronic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114616783 14:24072678-24072700 ATGGGGCTGGAGAGGGCTGAAGG - Intronic
1114619607 14:24087411-24087433 ATGGGGAAAGAGGGGCAGGCAGG + Intronic
1114929024 14:27444070-27444092 TTTGGGAAGGGGAGGCAGGAGGG - Intergenic
1115393414 14:32879179-32879201 ATGGGGCCTGGGAGTCAGGAAGG - Intergenic
1115505151 14:34086670-34086692 AGGTGGCAGGAGACGGAGGAGGG + Intronic
1115530559 14:34323051-34323073 ATGGGGCAGGAGAGGAAGAAAGG + Intronic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116446042 14:45013033-45013055 ATGAGGCTGGAGAGGTAGGCTGG - Intronic
1116953630 14:50900793-50900815 ATGAGGCTGGAGAGGGAGGCAGG + Intronic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118308450 14:64675399-64675421 TGGGAGCGGGAGAGGCAGGAAGG - Intergenic
1119409329 14:74419908-74419930 ATGAGGCAGGAGAGGTGGGAAGG + Intronic
1119505261 14:75167372-75167394 AAGAGGCAGGGGAGGGAGGAAGG - Intronic
1119521148 14:75286452-75286474 ATGTGCCAGGAGTGGAAGGAAGG - Intergenic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1119853033 14:77879554-77879576 GTGGGGCAGGAGAGGTAGGCCGG + Intronic
1119894490 14:78208444-78208466 AAGGGGGAGGAGAGGTGGGAAGG - Intergenic
1119907171 14:78316431-78316453 AGGGAGCTGGAGATGCAGGAAGG + Intronic
1120309178 14:82808347-82808369 AGGAGGCTGGAGAGGCAGGGTGG - Intergenic
1121014176 14:90538411-90538433 TTGGGGAAGGAGAGGCAGCCAGG + Exonic
1121105147 14:91274505-91274527 ATGGGGGATGAGAGGCCGGCAGG + Intronic
1121117639 14:91354944-91354966 GTGTGGCAGGAGAGACAGGTGGG + Intronic
1121305424 14:92903688-92903710 AGGGGGCAGGACACACAGGAAGG + Intergenic
1121438771 14:93935669-93935691 CTGGGGCTGGAGGGGCAGGTGGG + Intronic
1121565520 14:94906672-94906694 ATGGGTCAGGCAGGGCAGGATGG + Intergenic
1121605664 14:95238114-95238136 TTGGGGCTGGAGGGGCAGGCAGG - Intronic
1121712742 14:96051665-96051687 AGAAGGCAGGAGATGCAGGAAGG - Intronic
1122290665 14:100678758-100678780 CTGGAGCAGGAAAGCCAGGAGGG + Intergenic
1122292407 14:100686862-100686884 TGGGGGCTGGAGAGGCAGGAGGG + Intergenic
1122325053 14:100876832-100876854 ATGGGGCAGGGGAGCCAAGGAGG + Intergenic
1122325914 14:100880591-100880613 TTGGGTCAGGAGTGGCAGGAAGG + Intergenic
1122350521 14:101087278-101087300 ATGGGGCTGGAGAGGTGGGTAGG + Intergenic
1122369816 14:101223291-101223313 AGAGGGCAAGAGAGGGAGGAGGG + Intergenic
1122425755 14:101604474-101604496 CGGGAGCAGGAGAGGCAAGAAGG + Intergenic
1122470172 14:101961016-101961038 AGGGGTCAGGAGAGCCAGGTGGG + Intergenic
1122717369 14:103703631-103703653 AGGGGGAAGGAGGGGCAGGGTGG - Intronic
1122784652 14:104158107-104158129 ATGGGGCCCGAGAGGCCGGCAGG - Intronic
1122969123 14:105145302-105145324 TGGGGGAAGGAGAGGCAGGGCGG + Intronic
1123007140 14:105329412-105329434 GTGGGGCAGGAGCAGCAGGCAGG - Intronic
1123173805 14:106399155-106399177 CTGGAGCAGGCGAGCCAGGATGG + Intergenic
1123182058 14:106480429-106480451 CTGGAGCAGGCGAGCCAGGATGG + Intergenic
1202944847 14_KI270726v1_random:16301-16323 CTGGAGCAGGCGAGCCAGGATGG - Intergenic
1123827780 15:24101130-24101152 ACTGGGCAGGGGAGGCAGGGAGG + Intergenic
1123842234 15:24260539-24260561 ACTGGGCAGGGGAGGCAGGGAGG + Intergenic
1123857261 15:24426601-24426623 ACTGGGCAGGGGAGGCAGGGAGG + Intergenic
1123861890 15:24477129-24477151 ACTGGGCAGGGGAGGCAGGGAGG + Intergenic
1124190791 15:27574619-27574641 GAGGGGAAGGAGGGGCAGGAGGG - Intergenic
1124203243 15:27696544-27696566 ATGAGCCAGGACACGCAGGAAGG + Intergenic
1124256497 15:28146889-28146911 AAGAGGCAGGGGAGGAAGGAGGG + Intronic
1124337457 15:28868032-28868054 AGGAGGCTGGAGAGGCAGGAGGG - Intergenic
1124342505 15:28899273-28899295 ATGAGGCAGGGAAGGCAGGTGGG - Intronic
1124442630 15:29698391-29698413 ATGTGGCAGTAAATGCAGGAAGG - Intergenic
1124567733 15:30832204-30832226 AAGAGGCAGGGGAGGAAGGAGGG - Intergenic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1126557020 15:49999839-49999861 ATGGGGTGGGAAAGGCAGGGAGG - Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127393127 15:58522671-58522693 AGAGGGCAGCAGGGGCAGGAAGG - Intronic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127806512 15:62525989-62526011 ATGGTGCAGGTGGGGCAGGAAGG + Intronic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1128058232 15:64716861-64716883 ATGAGGCTGGAGGGGCAGGAGGG - Intergenic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128341101 15:66823023-66823045 ATGGTGGATGAGAGGAAGGATGG - Intergenic
1128549916 15:68591411-68591433 ATGTGGCTGGACAGGCAGGCAGG + Intronic
1128997405 15:72307002-72307024 CGGGTGCAGGAGAGGCAGGGAGG + Intronic
1129119682 15:73388447-73388469 ATGGGGCAGGTGAAGAGGGAGGG + Intergenic
1129168216 15:73791381-73791403 ATGGGGCAGGAAGGGCTGGCTGG - Intergenic
1129294491 15:74592471-74592493 ATGGGGTAGGAGGGGCAGCCTGG - Intronic
1129322321 15:74782178-74782200 GTGGGGCAGGAGCGGGAGGGCGG - Exonic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1129737062 15:77972392-77972414 GTGGGACAGGAGAGACAGGATGG + Intergenic
1129776623 15:78241198-78241220 TGGGGGCAGGGGAGGAAGGACGG - Intronic
1129824312 15:78624793-78624815 ATGGTGATGGAGAGGCAGGCCGG + Exonic
1129849019 15:78781243-78781265 ATGGGACAGGAGAGACAGGATGG - Intronic
1129866697 15:78914390-78914412 ACTGGCCAAGAGAGGCAGGAAGG + Intergenic
1129930556 15:79407112-79407134 AAGAGTCAGGAGAGCCAGGAAGG - Intronic
1129997116 15:80016514-80016536 GTGTGGAAGGAGAGGCAGGGGGG + Intergenic
1130037886 15:80378223-80378245 ATGAGGCTGGAGAGGCAGCCAGG + Exonic
1130121358 15:81050446-81050468 ATAAGGCTGGAGAGGCAGGTAGG + Intronic
1130167099 15:81472707-81472729 ATGGGACAGAAGAGACAGCAAGG - Intergenic
1130243841 15:82224577-82224599 ATGGGGCAGGAGAACCAGCTAGG + Intronic
1130282788 15:82532380-82532402 CTGTGGCAGGAGAGGCGGGCAGG + Intergenic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130312482 15:82767451-82767473 GAGGAGCTGGAGAGGCAGGAAGG + Intronic
1130456636 15:84116707-84116729 ATGGGGCAGGAGAACCAGCTAGG - Intergenic
1131225936 15:90624446-90624468 ATGGGGAGGGAGAGGCAGGCGGG - Intronic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131402288 15:92134880-92134902 GTGGGGCAGGGGTGGAAGGAGGG + Intronic
1131540193 15:93269249-93269271 AGGGAGCAGGAGAGACGGGAGGG + Intergenic
1132105808 15:99061876-99061898 ATTGGGCAGGAAATGAAGGAAGG + Intergenic
1132399460 15:101496556-101496578 AAGGGGCGGCAGGGGCAGGAAGG - Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132584395 16:700031-700053 AGGGGGGAGGGGAGGCAGGGAGG + Intronic
1132758417 16:1497120-1497142 TCGGGGCAGGATGGGCAGGAAGG - Intronic
1132782813 16:1637424-1637446 AGGGCACAGGTGAGGCAGGAAGG + Intronic
1132911949 16:2318307-2318329 GTGGGGCAGGTGAGGAAGGAAGG - Intronic
1132987344 16:2774461-2774483 TGGGGCCAGGAGGGGCAGGAGGG + Intronic
1133014757 16:2934189-2934211 GTGGGGCAGGTCAGGCTGGAAGG - Intronic
1133610544 16:7429321-7429343 TGAGGGAAGGAGAGGCAGGATGG - Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134031625 16:10996626-10996648 ATGGGGCCGCAGAGGAAGGGAGG - Intronic
1134102086 16:11459740-11459762 ATGGGGCTGGAGATGCAAAAGGG + Intronic
1134208798 16:12259055-12259077 AGAGGGCAGGAGAGAGAGGAGGG - Intronic
1134241824 16:12512259-12512281 GTGCGGCTGGAGAGGCAGGTGGG + Intronic
1134812163 16:17177004-17177026 ATGAGGCCAGAGAGGCAGGTGGG - Intronic
1135608173 16:23840744-23840766 ATGGGTTGGGAGAGGAAGGATGG + Intronic
1135630568 16:24033019-24033041 ATGTGGTAGGAAAGGCAGGTGGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135967615 16:27049007-27049029 GTGAGGCTGGAGAGGTAGGAGGG - Intergenic
1135969302 16:27060734-27060756 ATGGGGAATGAGAGGAAGCAAGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136067016 16:27766278-27766300 ATGGGGACGGAGCGGCAGGGGGG - Intronic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1136532138 16:30876821-30876843 AAGGGGCAGGAGAGGTGGGCAGG + Intronic
1137366537 16:47864388-47864410 ATTGGAAAGGAGAGGAAGGAAGG + Intergenic
1137371219 16:47907408-47907430 ATGGGGCTAGAGCTGCAGGATGG + Intergenic
1137501278 16:49013399-49013421 ATGTGGCATGATTGGCAGGAAGG + Intergenic
1137541710 16:49367405-49367427 AAGGGGAAGGAGAGGCAGAGTGG - Intergenic
1137558221 16:49486508-49486530 ATTTGGCAGGTGAGGCGGGATGG - Intergenic
1137608845 16:49805513-49805535 AGGGGCCGAGAGAGGCAGGATGG - Intronic
1137625142 16:49903032-49903054 AGGGGGCAAGAGTGGAAGGAAGG + Intergenic
1137692661 16:50440428-50440450 ATGATGCTGGAGAGGCAGGTGGG + Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138580700 16:57939062-57939084 AAGTGGCAGGAGAGGCTGGCAGG + Intronic
1138894232 16:61183469-61183491 ATGAGGCACCAGAGACAGGAGGG + Intergenic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139332654 16:66205539-66205561 AAGGGGGAAGACAGGCAGGAGGG + Intergenic
1139472675 16:67186693-67186715 AGTGGGGAGGAGAGGAAGGAGGG - Intronic
1139662117 16:68428407-68428429 ATGGGGCAGGAGCGGGGTGAAGG - Intronic
1139680192 16:68555408-68555430 ATGGGGCAGAGGAGCCAGTATGG + Intronic
1140118604 16:72064392-72064414 ATGGGTAAGGACTGGCAGGAAGG - Intronic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1140732932 16:77872549-77872571 GTTGGGCTGGAGAGGCAGGTGGG - Intronic
1140733161 16:77874445-77874467 GTTGGGCTGGAGAGGCAGGTGGG - Intronic
1140822373 16:78674646-78674668 ATGGGGCAGGAGATAAAGGCAGG - Intronic
1141076560 16:81011086-81011108 AGGGGACAGCAGAGACAGGAAGG - Intronic
1141335029 16:83146504-83146526 CTGGGGCAGGAGTAACAGGAAGG + Intronic
1141489549 16:84362912-84362934 AGGAGTCAGGAGAGGCAAGAAGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141659474 16:85434240-85434262 ATGGGGCAGGAGGGGCTGTAAGG - Intergenic
1141702107 16:85647239-85647261 AGGGTGCAGGGCAGGCAGGAGGG - Intronic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1142052079 16:87965394-87965416 CTGGGGCTGGAGGGGCAGGAGGG + Intronic
1142114262 16:88348219-88348241 AGGAGCCAGAAGAGGCAGGAAGG - Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142238660 16:88935218-88935240 CTGGCGCAGGAGAGGCTGCATGG + Intronic
1142305136 16:89280469-89280491 ACGGGGCAGGAGAGGCGGGAGGG + Exonic
1142307689 16:89294772-89294794 CTGGGGTAGGAGGGGCAGGCAGG - Intronic
1142360169 16:89622264-89622286 AGGGGAGGGGAGAGGCAGGAGGG + Intronic
1142746304 17:1960433-1960455 ACGGGGCTGGAGAGGGAGGTGGG - Intronic
1142748087 17:1970537-1970559 GTGGGACAGGCGTGGCAGGAGGG + Intronic
1142759571 17:2034852-2034874 ATGGGGCAGCAGGGGAGGGAGGG - Intronic
1142961048 17:3552826-3552848 AAGGGGCAGGAGAGCCAGGGAGG + Intronic
1143465123 17:7131384-7131406 ATGGGGCCAGAGAGGGAGGCAGG + Intergenic
1143625468 17:8108095-8108117 ACGTGGCAGGACAGGAAGGAGGG + Intronic
1143712017 17:8741814-8741836 ATGGGGCAGAAGAGGGGTGAAGG + Intronic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144101213 17:11943779-11943801 ATAAGGAAGGAGAGACAGGAGGG + Intronic
1144327711 17:14197563-14197585 ATGGGGTAAGTGAGGTAGGATGG + Intronic
1144418028 17:15070061-15070083 ATGGTGCAAGACAAGCAGGATGG + Intergenic
1144662707 17:17081614-17081636 AGCGTGCAGGAGAGGGAGGAAGG + Intronic
1145267604 17:21387973-21387995 GTGGGGGAGGAGTGGAAGGAAGG - Intronic
1145684087 17:26637637-26637659 CTGAGGCAGGAGAGTCAGGCAGG - Intergenic
1145933521 17:28702050-28702072 TTGGGGCAGGAGGGAGAGGAGGG + Exonic
1146164072 17:30574636-30574658 GTGGGGCAGCAGGGGAAGGAAGG - Intergenic
1146455825 17:33009047-33009069 AAGGGGCATGAGAGGTAGGCAGG - Intergenic
1146543934 17:33721855-33721877 ATGTGGCAGGAGCTGCAAGAAGG + Intronic
1146638826 17:34525384-34525406 GTGGGGCTGGAAAAGCAGGAAGG + Intergenic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1146784721 17:35709316-35709338 ATTCAGCAGGACAGGCAGGAAGG - Intronic
1146921865 17:36718547-36718569 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1147160891 17:38568925-38568947 ATGGGGCAGGGGTCGGAGGAGGG + Intronic
1147335877 17:39726789-39726811 TGGAGGAAGGAGAGGCAGGATGG - Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147449907 17:40497733-40497755 ATGGGGCGGGGGAGGCAGGCTGG + Intronic
1147571414 17:41573383-41573405 ATGGGGCAGGAATGGAAAGATGG - Intergenic
1147578017 17:41613650-41613672 AGGTGGCTGGAGGGGCAGGATGG - Intronic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1148210339 17:45804700-45804722 ATGGGGCAGGCAGGGAAGGAGGG + Intronic
1148332697 17:46821636-46821658 AGAGGGCAGAAGAGGCAGCAAGG + Intronic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148486359 17:47993504-47993526 ATGGAGCAGGAGGGGAAGAAAGG + Intergenic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148673627 17:49432020-49432042 GTGAGGCATGAGAGGCAGCATGG + Intronic
1148684026 17:49490717-49490739 AGGGGGCAGGAGAGGAGGGGTGG - Intergenic
1148746279 17:49920118-49920140 AGGGGGCCGGACAGGTAGGAGGG - Intergenic
1148859148 17:50595081-50595103 ATGGGGCACGGGAGGCATGCCGG - Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148873993 17:50675784-50675806 GTGGGGCAAGAGGGGCTGGAGGG + Intronic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149546804 17:57510003-57510025 CTGGGGCATGGGAGGCAGAAAGG + Intronic
1149589678 17:57819131-57819153 AGGGGGCAAGGGAGGCAGGACGG - Intergenic
1149679879 17:58498547-58498569 AGGGGGGAGGAGGGGGAGGAGGG + Intronic
1150121907 17:62610718-62610740 AGGTGGTAAGAGAGGCAGGAGGG + Intronic
1150229785 17:63543733-63543755 GTGGCGCTGGGGAGGCAGGATGG - Intronic
1150559302 17:66281104-66281126 ACGGGGCTGGAGAGGCTGAAAGG - Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1151037781 17:70821332-70821354 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1151425815 17:74030456-74030478 ATGGGCCAGGAGAGGAAGGTGGG - Intergenic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151732100 17:75917690-75917712 CCGTGGCAGGAGGGGCAGGAGGG + Intronic
1151842645 17:76628796-76628818 ATGGGGGAGGAGGAGCAGGCAGG - Intronic
1151919177 17:77140965-77140987 AGGGGGCCGGGGAGGCGGGAGGG - Intronic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1152008111 17:77695042-77695064 ATAAGGCAGGTGGGGCAGGAGGG + Intergenic
1152009227 17:77700675-77700697 CTGGGGCTGGGGAGGCAGGGAGG + Intergenic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152251846 17:79216501-79216523 AGGGGGCAGGAGTGAGAGGAGGG + Intronic
1152400809 17:80065164-80065186 AGAGGGGAGGAGAGGGAGGAGGG - Intronic
1152444760 17:80335327-80335349 AAGAGGCAGAGGAGGCAGGAGGG + Intronic
1152451449 17:80383777-80383799 CCGGGGCAGGTGGGGCAGGAAGG - Exonic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152569671 17:81116185-81116207 ATTAGGCAGGAGAAGCAGCAGGG - Intronic
1152709104 17:81861325-81861347 ATGGGGCTGGAGAGACGGGCGGG + Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152861216 17:82698016-82698038 GCGGGGCAGGAGGGGCGGGAGGG - Intronic
1153206230 18:2705167-2705189 ATGGGGCAGGCAAGGTAGGTTGG + Intronic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1154205760 18:12335456-12335478 AAGGGGAAAGAGTGGCAGGAAGG - Intronic
1154218270 18:12431535-12431557 ACGGGGGCGGAGAGGCTGGAGGG - Exonic
1154326962 18:13398150-13398172 TTGGGGCAGGAGGGGACGGAGGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155446835 18:25921730-25921752 ATGGGGCAGTAAATGCAGAAAGG - Intergenic
1155577812 18:27267064-27267086 TTGGGGAAGGAGTGGGAGGAGGG + Intergenic
1155621640 18:27786361-27786383 ATGGGGCAGAAGAGTCAGAGAGG + Intergenic
1155638683 18:27986026-27986048 AATGGGCAGGAGGGGCAGGGAGG - Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156422717 18:36972734-36972756 ACGGGACAGGAGAGACAGGTTGG - Intronic
1156463292 18:37333634-37333656 AGGGTGGAGGAGAGGCAGCACGG - Intronic
1156778470 18:40821947-40821969 CTGGAGCTGGGGAGGCAGGATGG + Intergenic
1156907399 18:42370307-42370329 ATGGAGGAGGTGAGGCATGAAGG + Intergenic
1157582774 18:48782925-48782947 ATGGGGCAGGAGTGGGAAGTGGG + Intronic
1157688237 18:49660342-49660364 ATGGGACAGGTAAGGCTGGAGGG - Intergenic
1157913727 18:51643711-51643733 CTGGGGAAGGACAGGAAGGAAGG + Intergenic
1158006878 18:52682514-52682536 ATGAGGCTGGAGAGGCGGGCAGG + Intronic
1158123898 18:54081465-54081487 ATGGGGATGGAAAGGGAGGAAGG - Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158468338 18:57711926-57711948 GAGGGACAGGAGAGGCAGGAAGG + Intronic
1158872769 18:61704646-61704668 ATGAGGGATGAGAGACAGGAGGG - Intergenic
1158973398 18:62688814-62688836 CTGGGGCAGGAGAGCCGGAAGGG + Intergenic
1160121120 18:76131183-76131205 ATGAGGCTGGAGAGGCAGGCAGG - Intergenic
1160169966 18:76544784-76544806 CTGGTGCAGAAGAGGCAGGGGGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160533832 18:79580788-79580810 ATGGAGCGGGAGAGGCCGCAGGG - Intergenic
1160779343 19:870931-870953 CTGGGGCAGGACATGCAGGGAGG + Intronic
1160785379 19:897932-897954 ATGGGGAAGGGGAGGCCGGTGGG - Intronic
1160952777 19:1675583-1675605 CTGGGGCAGGAGGGGCGGCAGGG + Intergenic
1160963918 19:1737253-1737275 ATGGCGACGGGGAGGCAGGAAGG + Intergenic
1160965689 19:1746077-1746099 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965720 19:1746158-1746180 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160978699 19:1806719-1806741 CGGGGGCAGGAGAGGCTGGACGG - Intronic
1160979931 19:1812185-1812207 CCGGCGCAGGAGAGGCAGGGGGG + Exonic
1161238631 19:3209930-3209952 AGCTGGGAGGAGAGGCAGGAAGG - Intergenic
1161242564 19:3230536-3230558 ATGAGGCTGGAGAGTCAGCATGG + Intronic
1161297540 19:3527364-3527386 AAGGGGCAGGGTAGTCAGGAAGG + Intronic
1161303681 19:3555732-3555754 AGGTGGCAGGAGGGGCAGGCGGG - Intronic
1161343220 19:3753927-3753949 CTGGGGCGGGAGAGGCAGCCTGG + Intronic
1161397086 19:4050459-4050481 ATGGGGCGAGACAGGCAGGGAGG - Intronic
1161425299 19:4199716-4199738 ATGGGGCAGGGGCCGCAGGGCGG - Exonic
1161466399 19:4433058-4433080 CTGGGCCAGGACTGGCAGGAGGG - Exonic
1161509248 19:4661617-4661639 ATGGGGATGGAGGGGCAGCAGGG + Intronic
1161517230 19:4703222-4703244 ATGGGGCTGGACAGGCAGAGTGG + Intronic
1161633090 19:5369203-5369225 ATGGGGTAGGAGCCACAGGATGG - Intergenic
1161703124 19:5805458-5805480 AAGGGGCAGGCGGGGCAGGTGGG + Intergenic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162323743 19:9986349-9986371 AAGGGGCAGGCGGGGCAGGCTGG - Exonic
1162565208 19:11442150-11442172 ATGGGGCTGGAGAATCAGGCAGG + Intronic
1162951925 19:14076226-14076248 GTGCGGGAGGAGAGGAAGGAAGG + Intergenic
1163102887 19:15108384-15108406 ATGAGACAGGAGAGGAGGGAGGG + Intronic
1163545042 19:17936368-17936390 ATGGGGGAGCAGGGGCCGGAGGG - Intronic
1163691696 19:18742016-18742038 GTGGGGCTGGGCAGGCAGGAAGG - Intronic
1163717511 19:18880560-18880582 GCAGGGCAGGCGAGGCAGGAAGG - Intronic
1163775171 19:19213132-19213154 TGGGGGCAGGGCAGGCAGGAAGG + Intronic
1163827814 19:19533447-19533469 AGGGGGCAGGAGGAGGAGGAAGG - Intronic
1164426041 19:28142666-28142688 AGGGGAAAGGAGAGGAAGGAAGG + Intergenic
1164539965 19:29115065-29115087 AAGAAGCAGGAGAGGAAGGAAGG - Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164956615 19:32392142-32392164 AGGGGGAGGGAGAGGAAGGAAGG + Intergenic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1165188950 19:34046177-34046199 ATGGGGCATGTGACCCAGGATGG - Intergenic
1165230525 19:34383705-34383727 CTGGGGCAGGTGAGGCAGGCAGG + Intronic
1165312619 19:35038046-35038068 CTGGGGCAGGGCAGGCAGGGGGG + Intronic
1165425379 19:35742629-35742651 ATGGGGCAGGAGAGTGAAGGGGG + Exonic
1165461309 19:35945714-35945736 ATGGTAGAGGTGAGGCAGGAGGG + Exonic
1166081199 19:40444833-40444855 AGGGGGCGGGAGGGGCAGCAAGG - Intergenic
1166298997 19:41903796-41903818 GGGGGGCGGGGGAGGCAGGAGGG - Intronic
1166326053 19:42051835-42051857 AGGCAGCAGGAGCGGCAGGAGGG - Intronic
1166327997 19:42062894-42062916 ATGGGGAAGGAGAGGAGGCAGGG - Intronic
1166347540 19:42175954-42175976 ATGGGGGGGGAGAGGTAAGAGGG - Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166734432 19:45075950-45075972 AGGGGGCCTGAGGGGCAGGACGG + Intronic
1166770090 19:45276520-45276542 AGAAGGCAGGAGAGGCAGTAGGG + Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167076641 19:47254210-47254232 GAGGGGCAGGAGAGGCCGGAGGG - Intergenic
1167115934 19:47489080-47489102 CTGGGGCAGGAGGAACAGGATGG + Intronic
1167433974 19:49468580-49468602 TACGGGGAGGAGAGGCAGGAAGG - Intronic
1167466637 19:49653733-49653755 CTGGGGCAGGTGAGACAGGATGG + Intronic
1167582973 19:50357413-50357435 CTCGGGCAGGAGAGTCAGGGAGG - Intronic
1168255727 19:55164047-55164069 AAGGGGCAAGAGAGGCAGTGGGG - Intronic
1168357735 19:55712897-55712919 AGGGGGGAGGAGATGGAGGAGGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
924982301 2:235341-235363 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982314 2:235382-235404 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982321 2:235401-235423 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982328 2:235420-235442 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982348 2:235483-235505 ACGGGCCAGGGGAGGCAGCATGG + Intronic
924982355 2:235502-235524 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982362 2:235521-235543 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982382 2:235584-235606 ACGGGCCAGGGGAGGCAGCATGG + Intronic
924982389 2:235603-235625 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982409 2:235666-235688 ACGGGCCAGGGGAGGCAGCATGG + Intronic
924982423 2:235707-235729 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982442 2:235770-235792 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982448 2:235789-235811 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982455 2:235808-235830 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982482 2:235893-235915 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982508 2:235978-236000 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982514 2:235997-236019 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982521 2:236016-236038 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982534 2:236057-236079 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982541 2:236076-236098 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982561 2:236139-236161 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982595 2:236246-236268 ATGGGCCAGGGGAGGCAGCATGG + Intronic
925034252 2:673763-673785 GGGGGGAAGGAGAGGAAGGAGGG + Intronic
925085041 2:1101204-1101226 AGGGGGCAGCAGGGGCAGGCAGG - Intronic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925163266 2:1701611-1701633 ATGGGGTGGGGGACGCAGGATGG + Intronic
925219328 2:2125127-2125149 AAAGGGCAGAAGAGACAGGAAGG - Intronic
925285284 2:2711794-2711816 GTGGCCCAGGAGATGCAGGAAGG + Intergenic
925476355 2:4221069-4221091 AGGTGCAAGGAGAGGCAGGAGGG - Intergenic
925565140 2:5244347-5244369 AAGGGGCAGGAAAGGATGGAGGG - Intergenic
925967103 2:9076231-9076253 ATGGGGCTGTAGGGGCAGAAAGG - Intergenic
926114967 2:10207189-10207211 ATGGGGGAGGTGAGGGAGAAGGG - Intronic
926172621 2:10561873-10561895 CTGAGGCAGGAGTGTCAGGAGGG - Intergenic
926335281 2:11858174-11858196 AGGGAGCAAGAGAGCCAGGAGGG + Intergenic
926689800 2:15725408-15725430 ATGAGCCAGGAGACGGAGGAAGG - Intronic
926761714 2:16284121-16284143 ATGTGGGAGGAGAGGCAGAGGGG - Intergenic
926924451 2:17972985-17973007 AAGGGGCTGGAGAGGGAGGCAGG + Intronic
926974050 2:18495497-18495519 AAGGGGAAGGGGAGGAAGGAAGG - Intergenic
927095346 2:19744090-19744112 ATGGGGCAGTGGAGGCAGAGGGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927485958 2:23488517-23488539 CTGGGGAAGGAGAGGCCTGATGG + Intronic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927622660 2:24678028-24678050 TGGGGGCAGGGGTGGCAGGAGGG - Intronic
927697474 2:25247840-25247862 GGGGGGCAGGACAGCCAGGAGGG + Intronic
927706374 2:25298939-25298961 ATGGGACAGTAGAGGCGGGGGGG - Intronic
927752337 2:25680547-25680569 ATGGGGCTGGAGAGGTTGGAGGG + Intergenic
927886418 2:26721391-26721413 TTGGGGGAGGAGAGGAGGGAGGG - Intronic
928180942 2:29067871-29067893 TTGGGGCAGGGGCGGCAGGGAGG - Intronic
928201323 2:29249460-29249482 AAGGGACAGGAAAGGAAGGAGGG - Intronic
928386413 2:30872226-30872248 AGGAGGCAAGAGAGACAGGAGGG - Intergenic
928402274 2:30987722-30987744 GTGGGGGAGGAGGGGGAGGAGGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929836000 2:45400251-45400273 TGGGGGCAGGAAGGGCAGGAGGG + Intronic
930035901 2:47084863-47084885 ATGAGGCCTGAGAGACAGGAGGG + Intronic
930090505 2:47528181-47528203 AAGGGACAGGTGAGGCAGAAGGG + Intronic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
930171531 2:48256302-48256324 ATGGGGCAGGACTGGAAGCAGGG + Intergenic
930635046 2:53795198-53795220 ATGAAACAGGAGAGGCAGCATGG + Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931240919 2:60452011-60452033 AATGGGCAGGAGATGTAGGAGGG - Intronic
931434463 2:62234971-62234993 CAGGGGCAGGAGAGCCAGGGCGG + Intergenic
931508874 2:62965874-62965896 ATAGGGAAAGAGAGCCAGGAAGG - Intronic
931717082 2:65037786-65037808 GTGAGGCAGGAGAGGCAGGCGGG - Intergenic
931799825 2:65747672-65747694 GTAGGGCAGGGGAGGGAGGAAGG + Intergenic
932372860 2:71207394-71207416 ATGAGGTTGGAGAGGCAGGTGGG + Intronic
932478672 2:72024999-72025021 GCGTGGCTGGAGAGGCAGGAAGG - Intergenic
932574215 2:72954054-72954076 ATGTGGTAGACGAGGCAGGAAGG - Intronic
933704176 2:85277540-85277562 AGGGGTCCAGAGAGGCAGGAAGG + Intronic
933726736 2:85431290-85431312 ATGGGGCGGGTGGGGAAGGAGGG - Intronic
933920051 2:87036450-87036472 ATGAGGCAGGTGAGGCAGAACGG + Intergenic
933928445 2:87123182-87123204 ATGAGGCAGGTGAGGCAGAACGG + Intergenic
933931573 2:87157336-87157358 ATGAGGCAGGTGAGGCAGAACGG - Intergenic
934002944 2:87733448-87733470 ATGAGGCAGGTGAGGCAGAACGG - Intergenic
934568058 2:95351454-95351476 GTGGGGCATGAGAGGAAGGGAGG + Intronic
934610162 2:95729588-95729610 ATGAGGAAGGAGAGGCAGACAGG + Intergenic
934769547 2:96899119-96899141 ATGGGGAAGGAGCTCCAGGAAGG + Intronic
935065297 2:99642138-99642160 AGGGGGCAGGAGAGGGAGGGAGG + Intronic
935878823 2:107540652-107540674 ATGGGGCTGGGGAGGTAGGGAGG - Intergenic
935958951 2:108404936-108404958 AAGGTGCAGGAAGGGCAGGAAGG - Intergenic
936361547 2:111808098-111808120 ATGAGGCAGGTGAGGCAGAACGG + Intronic
936543495 2:113371186-113371208 ATGTGGAAGGAGAGGCAGACAGG + Intergenic
936923133 2:117709469-117709491 ATGGGAAAGGCAAGGCAGGAAGG - Intergenic
937145329 2:119639301-119639323 ATGTGGCTGGAGAGCCAGGCAGG - Intronic
937400187 2:121575740-121575762 GTGGGTGAGGAGAGGCAGAAAGG + Intronic
937491195 2:122370366-122370388 ATGGGGCAGTAGAGGCTTGGGGG - Intergenic
937650133 2:124310495-124310517 AGGGGGCATTAGAGGAAGGAAGG - Intronic
937679899 2:124632897-124632919 CTGGGGGAAGAGAGGCAGGCAGG + Intronic
938422869 2:131157727-131157749 CTGGGCCAGGAGATCCAGGAGGG - Intronic
938806426 2:134810545-134810567 AAGGGTCAGGATAGACAGGATGG + Intergenic
938927319 2:136055829-136055851 ATGCAGCGGGAGAGGAAGGAAGG - Intergenic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939490850 2:142874444-142874466 AGGGGAAAGGAGAGGCAGGAGGG + Intergenic
940452504 2:153857468-153857490 ATGGGGCAGGAGAACCAAGTAGG + Intergenic
941032900 2:160533241-160533263 ATTGTGCAGGAGAGGGAGAAAGG + Intergenic
941389548 2:164894837-164894859 ATGAGGCTGGAGATGTAGGAGGG - Intergenic
941509553 2:166388775-166388797 ATTGTGCAGGAGAAGCAGAACGG - Intergenic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941932777 2:170958910-170958932 TTGGGGCAGCAGAGGCGGGCGGG - Intronic
942043864 2:172087832-172087854 ATGGGGGAAGGGAGGAAGGAGGG + Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942186104 2:173426518-173426540 CTGGGGCAGGACAGACAGGCAGG - Intergenic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942495643 2:176537314-176537336 ATGGGGCAGGCCAGGCATGGTGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943797650 2:192017203-192017225 GTGAGGCTGGAGAGGCAGGTGGG + Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
944052031 2:195480703-195480725 ATAGGGCAGGAGAGGGAGAAAGG - Intergenic
944074030 2:195706763-195706785 ATGGGGCAGTAGATGAAGAAGGG - Exonic
944142050 2:196467366-196467388 AGGGGGAGGGAGAGGAAGGAGGG + Intronic
944293904 2:198040474-198040496 ATAGGGGAGGAGAGGCAGAGAGG + Intronic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
944935170 2:204560562-204560584 ATGGGGCAGGACATGAGGGAGGG + Intronic
945113515 2:206388053-206388075 ATTGTGGAGGAGGGGCAGGAAGG + Intergenic
945121590 2:206462943-206462965 ATGGGGCAAGAGTGGCTGCAGGG + Intronic
945630198 2:212265047-212265069 ATGCTGCAGGAGAGGCACAAGGG + Intronic
945965434 2:216181419-216181441 ATGGGTCGGGAGTGGCAGAATGG - Intronic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946380957 2:219348642-219348664 ATGAGACAGGAGAGGCTGGCAGG + Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946484700 2:220089673-220089695 AGGGGCCAGGAGAGCCAGGCTGG - Intergenic
946993642 2:225365165-225365187 TTGGGGGAGGAGAAGCAGCAGGG - Intergenic
947014524 2:225603631-225603653 ATGGGCCAGGAGAACCAGAATGG - Intronic
947040545 2:225913945-225913967 ATGGGGAAGGAAAAGCATGAAGG - Intergenic
947181287 2:227413600-227413622 AGCGGGCGAGAGAGGCAGGAGGG + Intergenic
947604850 2:231479265-231479287 ATGGGGCTGGAGAGGCAGGTAGG + Intronic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948230003 2:236342529-236342551 ATGGCTCTGGAGACGCAGGAAGG + Intronic
948317707 2:237041669-237041691 AAGGGGCAGGAGGGGCAAAAAGG + Intergenic
948333739 2:237192013-237192035 AAGGGGAAGGTGAGGCAGGGAGG - Intergenic
948449413 2:238060236-238060258 TTGGGGCATGAGGGACAGGAAGG - Intronic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
948893005 2:240916227-240916249 ATGGGAGAGGAGGGGAAGGAAGG - Intergenic
948918100 2:241048475-241048497 CTGGGGCAGGAGACCCAGGGAGG + Intronic
948955410 2:241286529-241286551 TTCGGTCTGGAGAGGCAGGATGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
948990608 2:241552025-241552047 AGGAGGCTGCAGAGGCAGGAGGG + Intergenic
949028832 2:241778789-241778811 TTCGGTCTGGAGAGGCAGGACGG + Intronic
949030310 2:241793008-241793030 TTCGGTCTGGAGAGGCAGGATGG - Intronic
949060357 2:241953255-241953277 AGGGGGGAGGAGAGGGAGAAGGG + Intergenic
1168767045 20:388712-388734 AAGGGGCAGGAGATGAAGGTTGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1168931701 20:1629612-1629634 ACGTGGCAGGGGAGGAAGGAAGG + Exonic
1168986428 20:2052889-2052911 ATGGGGCAGGAAAGGCAGGGAGG + Intergenic
1169020356 20:2326422-2326444 ATGGGGCAGGAGACAGAGGGAGG - Intronic
1169112386 20:3042677-3042699 ATGGGGGAGGGGAGGCATAATGG - Intergenic
1169150286 20:3284072-3284094 ATGGGGCTGGGGAGGGAGGGAGG - Intronic
1169325285 20:4670744-4670766 ATGGGGGAGGAGATGCAGCAAGG + Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1169765581 20:9144674-9144696 AGGGGGAAGGAGGGGGAGGAGGG + Intronic
1169765599 20:9144719-9144741 AAGGGGAAGGAGGGGAAGGAGGG + Intronic
1169769769 20:9188195-9188217 ATTAGGCAGGGGAGGAAGGATGG + Intronic
1170009960 20:11712159-11712181 ATGGGGCAGGGGAGGAAGCCTGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170126607 20:12970740-12970762 ATGGGACAGGAGAGAGAGCAAGG - Intergenic
1170589192 20:17758373-17758395 ATGAAGCTGGAGAGGCAGGTGGG + Intergenic
1170630010 20:18057736-18057758 AGAGGGCAGGCGAGGCGGGAAGG - Exonic
1170973761 20:21141288-21141310 ATGGGGGAAGGGAGGCAGGGAGG + Intronic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1171378999 20:24718948-24718970 ATGAGGCAGGGGTGGCAGCAGGG - Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172102756 20:32495430-32495452 GTGGTGCAGGAGAGGCAGATGGG + Intronic
1172311494 20:33921794-33921816 ATGGGGCATCAGAGCCAGAAGGG - Intergenic
1172441962 20:34972083-34972105 AAGGGGCAGGGGAGGCAGCGGGG - Intergenic
1172479615 20:35263397-35263419 AGGGGGCAGGAGAGGAAGGGTGG - Intronic
1172479746 20:35264017-35264039 ATGGGGCAGGGGACGAGGGAGGG + Intronic
1172578298 20:36026570-36026592 AGGTGGCAGGAGATGCTGGAGGG - Intronic
1172657126 20:36544065-36544087 ATGGGACAGAAGAGGCCGGCTGG + Intronic
1172764723 20:37345546-37345568 CTGGGGCAGGAGGGACAGGGTGG - Intronic
1172778304 20:37420669-37420691 ATGGGGAAGGAGGAGCAGGGAGG - Intergenic
1173226238 20:41163894-41163916 ATAGGCAAGGAGAGGCAGGTAGG - Intronic
1173370054 20:42427163-42427185 ATGGGGGAGAAGAGGAGGGATGG - Intronic
1173861629 20:46287622-46287644 ATGAGACAGGAGAAGCAGGCAGG + Intronic
1173876632 20:46376421-46376443 GTGGGGAGGGAGAGTCAGGAGGG - Intronic
1173888220 20:46480419-46480441 ATGGAGGAGGAGAGGCAGTTTGG - Intergenic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174145044 20:48447531-48447553 AGGAGGCAGGGGAGGGAGGAGGG + Intergenic
1174149387 20:48475476-48475498 ATGGAGCTGGAGACTCAGGAAGG - Intergenic
1174347191 20:49938946-49938968 ATGAGGCAGTAGAGACAGGCAGG - Intronic
1174365541 20:50054226-50054248 GTGTGGCAGGAGAGGCAGCCGGG - Intergenic
1174395475 20:50244307-50244329 ATGAGGAAGGCGAGGCAGCATGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1175160171 20:57002502-57002524 AGTGGACAGGAGAGGAAGGAAGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175321424 20:58090854-58090876 CTGAGACAGGAGGGGCAGGAGGG - Intergenic
1175503569 20:59466903-59466925 CTGGGGCTGCAGGGGCAGGAGGG + Intergenic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1175687272 20:61040767-61040789 AAGGGTCAGGAGATGCAGGTCGG + Intergenic
1175840747 20:62025599-62025621 TGGCGGCAGGAGAGACAGGAGGG - Intronic
1175843345 20:62045231-62045253 ATGGGCCAGGAGGTGCGGGACGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175988695 20:62776992-62777014 AGGGGGCGGGACAGGAAGGAGGG + Intergenic
1176109632 20:63405480-63405502 AGGGGGCAGGAGAGCTAGGGAGG + Intergenic
1176256974 20:64158036-64158058 GTGGGGCAGGTGGGGCAGGTGGG - Intronic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1177727355 21:24986792-24986814 ATGGGGCAGTAAATGAAGGATGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1178662008 21:34514804-34514826 AGGAGGCCAGAGAGGCAGGAGGG + Intronic
1178667821 21:34564343-34564365 ATGAAGCTGGAGAGGCAGGCAGG + Intronic
1178892495 21:36531653-36531675 ATGGGGCAGGAGTGTCAGAGTGG + Intronic
1178914604 21:36699430-36699452 CCGAGGCAGGAGAGGCAGGAGGG + Exonic
1179065378 21:38019934-38019956 GAGGGGCAGGAGAGGCAGAAGGG - Intronic
1179088579 21:38242607-38242629 GTGTGTCAGGAGAGGCACGAGGG - Intronic
1179121177 21:38547292-38547314 ATTGGGCTGGAGAGGGAAGAAGG + Intronic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179521131 21:41945767-41945789 AGGCGGCAGGAGAGGGAAGAAGG - Intronic
1179582693 21:42353418-42353440 ATCAGGCTGGAGAAGCAGGAAGG - Intergenic
1179778663 21:43685300-43685322 ATGGGGGAGGAGACACTGGATGG - Intronic
1179877215 21:44275188-44275210 GTGGGGCAGGTGGGGCAGGTGGG - Intergenic
1179877248 21:44275302-44275324 GTGGGGCAGGTGGGGCAGGTGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180002385 21:45001250-45001272 GTGGGGCAGGAGAGGCCGAGAGG + Intergenic
1180035879 21:45248949-45248971 AGGGGGCAGGAGGGGAAGGCGGG + Intergenic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180595060 22:16967672-16967694 ATGAGGCAGGAGCTGGAGGAAGG - Intronic
1180832249 22:18912236-18912258 CTGGGGCAGGAAAGGCTGGAGGG - Intronic
1181067593 22:20314106-20314128 CTGGGGCAGGAAAGGCTGGAGGG + Intergenic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181466803 22:23114806-23114828 GTGGGTGAGGACAGGCAGGAGGG - Intronic
1181528317 22:23502381-23502403 ATGGGGGATGAGAGGATGGAGGG - Intergenic
1181534354 22:23534007-23534029 ATGAGGAAGGGAAGGCAGGAGGG + Intergenic
1181589787 22:23876959-23876981 GTGGGGCAGGGGAGACAGGCTGG + Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181963708 22:26642031-26642053 AGGGGGCAGGAGAGGGAGAAAGG - Intergenic
1182005507 22:26956272-26956294 AAGGGGCAGGTGTGGCAGGAGGG + Intergenic
1182023520 22:27100300-27100322 ATGGGGCAGAAGAAGCAGTTGGG + Intergenic
1182236781 22:28883024-28883046 TTGGGGCGGGGGAAGCAGGAAGG + Intergenic
1182964301 22:34506888-34506910 AGGGGGCTGGAGTGCCAGGATGG - Intergenic
1183093444 22:35539063-35539085 ATGGGGCAGGTGGGGGTGGAGGG - Intergenic
1183107939 22:35627965-35627987 AGGGGGCAGGAGAAGCAGAGAGG + Intronic
1183255225 22:36757605-36757627 ATCTGGCAGCAGAGACAGGATGG + Intergenic
1183274587 22:36885658-36885680 ATGGGGAAGGAGAGGAGGGCGGG - Intergenic
1183284661 22:36954265-36954287 TTGGGGCAGGTGAGGAAGGATGG - Intergenic
1183353296 22:37345229-37345251 ATGGGGAGGGAGGGGCAGAAAGG - Intergenic
1183366950 22:37411917-37411939 TTGGGGCAGGGGCTGCAGGAAGG - Intronic
1183456005 22:37923768-37923790 ATGGGCCAGGACACACAGGAAGG - Intronic
1183539086 22:38419293-38419315 CGGGGGGAGGTGAGGCAGGAGGG + Intergenic
1183548141 22:38466302-38466324 ATGGGGAAAGCGAGGCAGGGAGG - Intergenic
1183867602 22:40716274-40716296 CAAGGGCAAGAGAGGCAGGATGG + Intergenic
1184110347 22:42390432-42390454 ATGGGACAGGAAAGGGAAGAGGG + Intronic
1184147035 22:42617782-42617804 ATGAGGCTGGAGAGGGAGGCGGG - Intergenic
1184226192 22:43130052-43130074 AAGGGGCACCAGGGGCAGGAGGG + Intergenic
1184286292 22:43473604-43473626 ATGGGCCTGGAGAGTCAAGATGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184514704 22:44954918-44954940 ATGGGACAGAGAAGGCAGGACGG + Intronic
1184535637 22:45084893-45084915 CTGGGGCAGGACAGGCAGAAGGG + Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184691445 22:46119168-46119190 AAGGGGGAGGGGAGGCAGCAGGG + Intergenic
1184791536 22:46703346-46703368 TGGGGGCAGGAGAGGCAGGAGGG - Intronic
1185336354 22:50272314-50272336 AAGCGGCAGGGGAGCCAGGAAGG + Intergenic
1185347901 22:50318549-50318571 CTGGGGCAGGAGCGGGAGGGAGG + Intronic
1203282334 22_KI270734v1_random:137541-137563 CTGGGGCAGGAAAGGCTGGAGGG - Intergenic
949386974 3:3513713-3513735 ATGGGACAGGAGAGGCAGACAGG + Intergenic
949549857 3:5104042-5104064 AGGGGGGAGGAGGGGGAGGAGGG - Intergenic
949570142 3:5284623-5284645 ATGAGGCAGGAGAATCAGGCAGG + Intergenic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950126547 3:10513390-10513412 AAGGGACAGGAGAGGCAGTGGGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950528063 3:13536190-13536212 ATGTGGGAGGAGGGGCAGGTGGG - Intergenic
950612122 3:14133479-14133501 GTGGGGCAGGACAGGCTGGCAGG + Intronic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950644806 3:14370865-14370887 CTGGGGCAGGGCAGGCAGAAGGG - Intergenic
950646566 3:14380852-14380874 AGGGAGCAGGGGAGGAAGGAAGG + Intergenic
950730531 3:14952767-14952789 ATGGGGAAAGAGTGGCAGGATGG - Intronic
950764134 3:15260742-15260764 GTGTGGCTGGAGAGGCAGGGTGG + Intronic
951044426 3:18022525-18022547 ATGGGCTAGAAGAGGCAGGCAGG - Intronic
951078707 3:18425822-18425844 GAGGGGCAGGACGGGCAGGACGG + Intronic
952272152 3:31843628-31843650 TTGGGGCAGCAAAGGAAGGAGGG - Intronic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
952984138 3:38762590-38762612 ATGAGGCAGAAGAGACAGTATGG + Intronic
953184528 3:40625806-40625828 GGGGGGCAGGAGAGACACGATGG - Intergenic
953340984 3:42134147-42134169 AAGGGGAAGGGGAGGAAGGAAGG - Intronic
953345477 3:42171964-42171986 ATGGGGACGGAGAGGGGGGATGG - Intronic
953391557 3:42536604-42536626 ATTGGGCAGAAGAGCCAGCAGGG - Exonic
953406686 3:42663320-42663342 TTGGGGAAGGAAGGGCAGGATGG - Intronic
953529383 3:43726373-43726395 ATGGGGTAGGAGGGGCACCAGGG + Intronic
953927923 3:46991763-46991785 ATAGGGCAGCATAGGAAGGAAGG + Intronic
954336846 3:49923375-49923397 AAGGGGAAGGAGGGGAAGGAGGG + Intronic
954347407 3:50012092-50012114 TTTGGGAAGGTGAGGCAGGAAGG - Intronic
954439515 3:50514094-50514116 AAGGGGCAGGGGAGGCAGGAAGG - Intergenic
954711414 3:52506795-52506817 CTTGGGCAGGATGGGCAGGATGG - Exonic
954802112 3:53193421-53193443 CTGGGGAAGGAGAGACAGGCAGG + Intergenic
954808978 3:53236387-53236409 ATGAGGCAGGAGAGGCTGCAGGG - Intronic
954924072 3:54217143-54217165 ATGGGGCCTGGGAGGGAGGAAGG + Intronic
955044707 3:55348873-55348895 ATGGGGAGGGGGAGGCAGGCGGG - Intergenic
955147903 3:56338443-56338465 GTGGGGGATGAGAGACAGGAAGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
955544926 3:60018186-60018208 AGGAGGCAAGAGAGACAGGAGGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955809151 3:62768377-62768399 ATGGGGCAGGAGAGGAATGGAGG + Intronic
956276005 3:67501828-67501850 ATGGGGCAGGGTATGCATGAAGG - Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957909812 3:86606816-86606838 ATATGGCAAGAGAGGCAGCAAGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958193593 3:90214222-90214244 ATGATGTAGGAGAGGCAGGTGGG - Intergenic
958416897 3:93885139-93885161 ATGATGTAGGAGAGGCAGGTGGG - Intronic
958841213 3:99208191-99208213 ATGAGGCAAGAGAGGCAGAAAGG - Intergenic
959205193 3:103298298-103298320 AAGGGGCAAGAGAGGAAGGGAGG - Intergenic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
959583239 3:108003117-108003139 CTGGGGATGGAGACGCAGGAGGG - Intergenic
959620002 3:108389751-108389773 ATAAGGCAGGAGAGGGAGTAGGG + Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960548231 3:118942861-118942883 GTGGGGCAGAGGAGGTAGGAGGG + Intronic
960562835 3:119104271-119104293 ATGAGGCAGGAGAGGTAGATAGG - Intronic
960624205 3:119664568-119664590 AAGAGGCAGGCGAGGCAGGCGGG + Intronic
960810971 3:121627319-121627341 ATGGGACAGGAAATGCAGGATGG + Exonic
960948941 3:122986537-122986559 ATAAGGCAAGAGAGGCAGGAGGG + Intronic
960996494 3:123343772-123343794 GTGGGGGAGGACAGGCAGGAGGG + Intronic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961566002 3:127763718-127763740 AAGGGGCGGGAGGGGAAGGAAGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961809493 3:129513771-129513793 ATGCGGGAGGAAGGGCAGGAGGG + Intronic
961829303 3:129615323-129615345 ATGAGGCAGGAGGTGCAGGAGGG - Intergenic
961832243 3:129629241-129629263 ATGGGCCAGGCCAGGGAGGACGG - Intergenic
962174345 3:133137434-133137456 CTGGGGCAGGCGTGACAGGATGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
962501342 3:135996829-135996851 AGGGGGCAGGAGAGGTATTAAGG - Intronic
962580191 3:136791138-136791160 ATGAGGCTGGAGAGGGAGCAGGG - Intergenic
962716944 3:138134544-138134566 ATAGGCCAGGAAAGGCAGAAAGG - Intergenic
962727746 3:138249737-138249759 AGAGGGAAGGAGAGGCAGGGAGG + Intronic
962875078 3:139529738-139529760 ATAGGGCTGGAGAGACAGGCAGG + Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962960834 3:140309747-140309769 ATAGGGAAGGAGAAGCACGAAGG - Intronic
962988050 3:140553749-140553771 AATGGGCAGGAGAGGAAGGGAGG - Intronic
963034093 3:141010131-141010153 TTTGGGAAGGTGAGGCAGGAGGG + Intergenic
963163381 3:142175491-142175513 ATGGGGCATGAAAGGAAGGAAGG - Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
963339089 3:144012566-144012588 AGGGGTGAGGAGAGGCAGGTAGG + Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
964381408 3:156101790-156101812 TTGGGGGAGATGAGGCAGGAAGG - Intronic
964518674 3:157540956-157540978 ATTGGGGAGGAGAGGCTGCATGG - Intergenic
964899303 3:161638579-161638601 ATGTGGCTGGAGAGGGATGATGG + Intergenic
966666181 3:182473441-182473463 ATGGGGGAGGGAAGGAAGGAGGG + Intergenic
966851499 3:184167754-184167776 ATGGGGCAGGGCAGGCCGGAGGG + Intronic
966878084 3:184335039-184335061 AAGTGGCTGAAGAGGCAGGATGG + Exonic
967185922 3:186944461-186944483 CTCGGGTAGGAGAGGCAGTATGG + Intronic
967424774 3:189314338-189314360 ATGGGGCTGGTGGGTCAGGAAGG + Intronic
967428171 3:189351292-189351314 ATGGGGCTAGGTAGGCAGGATGG + Intergenic
968459919 4:719668-719690 GTGGAGCTGGAGGGGCAGGACGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968703107 4:2065990-2066012 TGGGGGCAGGAGGGGCAGGGCGG + Exonic
968713560 4:2138244-2138266 ATGGGGTTGGAGAAGCAGGTGGG + Intronic
968717960 4:2175774-2175796 ATGGGGCATAGGGGGCAGGAGGG + Intronic
968949323 4:3682388-3682410 GTGGGGGCGGACAGGCAGGAGGG + Intergenic
968953250 4:3705597-3705619 ATGGGCCAAGACCGGCAGGAGGG - Intergenic
968959129 4:3734126-3734148 CTGGGGAAGGTGAGGCAGCATGG + Intergenic
969136739 4:5035423-5035445 ACACAGCAGGAGAGGCAGGAGGG + Intergenic
969370378 4:6727773-6727795 AGGGGACAGGAGGGGGAGGAGGG - Intergenic
969448136 4:7257086-7257108 GTGGGGCAGGAGAGAGAGAAGGG + Intronic
969448238 4:7257531-7257553 GTGGGGCAGGAGAGGGAGAAGGG - Intronic
969494653 4:7519752-7519774 AGGGGGAAGGAGGGGCAGAATGG - Intronic
969640876 4:8397724-8397746 ACGGGGCAGGGCAGGAAGGACGG - Intronic
969641494 4:8401713-8401735 ATGGGGCACCACAGGCAGGTGGG - Intronic
969687014 4:8681343-8681365 AAAGGGAAGGAGAGGCAGCAAGG - Intergenic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969787963 4:9473818-9473840 AGGGGGCAAGAGGGGCAGGCTGG - Intergenic
969817935 4:9699790-9699812 AGGTGGCAGGAGAGGCAGTCGGG + Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970505839 4:16729485-16729507 AGAGAGCAGGAGAGGGAGGAGGG + Intronic
970561161 4:17283586-17283608 AGGGGGCAGGAGAGGCTTCAGGG - Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971479641 4:27102950-27102972 AGGGGGCATGAGTGGCAGGCTGG - Intergenic
971779126 4:31007995-31008017 ATGGGGTAGGAGTTGCAAGAAGG + Intronic
971850770 4:31983911-31983933 ATGGTGCAGGAAAAGCAGAAAGG + Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972430893 4:38980801-38980823 GGGTGGCAGGAGAGGCGGGATGG + Intronic
973266634 4:48217732-48217754 TTGGGGCTGGAGGGGCAGGGAGG + Intronic
973634769 4:52851851-52851873 ATGGGGAAGGAGAGGCAAAGCGG - Intergenic
973825970 4:54708098-54708120 AGAGGGCAGGAGAGGCAGGGAGG + Intronic
974017919 4:56665963-56665985 AAGGGGCAGTAGAGCCAGGTGGG + Intronic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974992803 4:69115214-69115236 ATGGCGCAGGACTGGCAGGCAGG - Intronic
975390656 4:73813400-73813422 ATGAGGATGGAGAGACAGGATGG + Intergenic
976086598 4:81413166-81413188 ATGAGGCTGGAGAGGCAGCAGGG + Intergenic
976431467 4:84966775-84966797 AAGAGGAAGGAAAGGCAGGAGGG - Intergenic
976547948 4:86359561-86359583 GTGGGGCGGGAGAGGGAGTATGG - Intronic
976666794 4:87603436-87603458 AGGGGGAAGGAGTGGGAGGAAGG - Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
977014460 4:91675827-91675849 ATAGGGCAGAGGAAGCAGGAAGG + Intergenic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977630371 4:99236123-99236145 ATGAGACTAGAGAGGCAGGAAGG - Intergenic
977689475 4:99889667-99889689 ATGTGGCTGGAGAGGAAGGATGG + Intronic
978644640 4:110915457-110915479 ATGGGGGAGGAGAGGGAGTTTGG + Intergenic
978721890 4:111919902-111919924 ATGGGAGAGGAGTTGCAGGAGGG - Intergenic
979771212 4:124526818-124526840 ATGTGGCAGGAAAGTCAGGCAGG + Intergenic
980762900 4:137260303-137260325 ATGGGGCAGGAGATCAAGAAAGG - Intergenic
981547075 4:145904406-145904428 ATAGGGCAAGACAGGGAGGATGG + Intronic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982106574 4:152016568-152016590 ATGAGAGAGGAGAGACAGGAGGG + Intergenic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
983145425 4:164208172-164208194 AAGGGACTGGAGAGGCAGGGAGG + Intronic
984743806 4:183193888-183193910 ATGGGGGCGGAGAGGGAGAAAGG + Intronic
985132146 4:186749677-186749699 GTGGGGGAAGAGAGACAGGAAGG - Intergenic
985145184 4:186889156-186889178 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145190 4:186889176-186889198 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145196 4:186889196-186889218 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145202 4:186889216-186889238 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985146954 4:186903403-186903425 AAGGGGCCGGCAAGGCAGGACGG - Intergenic
985504788 5:272467-272489 ACAGGCCAGGAGAGGAAGGAAGG + Intronic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985552061 5:538753-538775 CTGGGGCAGGTGTGGCATGAAGG - Intergenic
985680401 5:1252954-1252976 GTGAGGCAGGAGGGGAAGGAGGG - Intergenic
985743327 5:1633128-1633150 ACAGGCCAGGAGAGGAAGGAAGG - Intergenic
985782891 5:1880316-1880338 GTGGGACAGGAGAGAAAGGAGGG + Intronic
985992732 5:3576697-3576719 TTGGGTCAGGATAAGCAGGAGGG + Intergenic
986468391 5:8050063-8050085 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
986469357 5:8058900-8058922 GAGGGGCAGCAGAGGCAGCACGG + Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
987091684 5:14513284-14513306 ATGGGGAAGGAGTGGGGGGATGG + Intronic
987259670 5:16190460-16190482 AAGGGGAAGGAGAGTCAAGAAGG + Intergenic
987779091 5:22409781-22409803 ATGGGGTAGGAGTGGTAAGAAGG - Intronic
988086917 5:26485250-26485272 ATGGCGCAGGACTGGCAGGCAGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990172033 5:53062273-53062295 AGAGAGCAGGAGAGTCAGGAAGG - Intronic
990605382 5:57404071-57404093 ATGGGGCAGGGGAGGTGGGGAGG + Intergenic
990948722 5:61275860-61275882 ATGGGGCTGGAGAAGGAGGTAGG - Intergenic
991051015 5:62272816-62272838 ATGGGGAAAGATAGGCTGGAAGG + Intergenic
991146826 5:63316785-63316807 ATGGGGGAAGAGTGGGAGGAGGG + Intergenic
991433594 5:66573394-66573416 AGGAGGGAGGAGAGGAAGGAGGG + Intergenic
991646788 5:68808300-68808322 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992758928 5:79934516-79934538 TTGGGGCAGGCAGGGCAGGATGG - Intergenic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993682749 5:90899756-90899778 ATGGAGCATGAGAGTCTGGAAGG - Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
995142307 5:108748513-108748535 ATGGGGCCGGAGACGGACGAAGG - Intronic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995337987 5:111024551-111024573 ATGGGGCAGAAGAGAAAGGAAGG - Intergenic
995632738 5:114151382-114151404 AGGGAGCTGGAGTGGCAGGACGG - Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996366121 5:122703223-122703245 ATGGAGGAGGAGTGGCAAGAAGG - Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996383396 5:122885247-122885269 CTTGGGGAGGAGAGGCAGGGAGG - Intronic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
996706567 5:126504180-126504202 GTGGACCAGGAGAGGCAGGTAGG - Intergenic
997457372 5:134027268-134027290 ATGGGGCGGGAGAGGGAGGAGGG - Intergenic
997499144 5:134357748-134357770 AATGGGAAGGAGAGGAAGGATGG - Intronic
997726016 5:136120385-136120407 ATGGGCCTGGAGAGGCGGGCAGG - Intergenic
998158864 5:139801877-139801899 ATGGGGCAGGAGAGAGAGAGGGG - Intronic
998427432 5:142040753-142040775 ATGGGACTGGGGAGACAGGACGG - Intergenic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
998834442 5:146190318-146190340 ATGGGTCAGCAGAGGTAGGCAGG + Intergenic
999131534 5:149287353-149287375 ATTGGGCAGGGTAGGCAGGAGGG + Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000120608 5:158194463-158194485 CTGGGTCAGGAAAGCCAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000706437 5:164518931-164518953 ATGGAGGAGGAGAGGCAAGGAGG + Intergenic
1000956406 5:167549028-167549050 GAGAGGCAGGAGAGGAAGGACGG - Intronic
1001116927 5:168947743-168947765 ATGGGGAAGGAGAGCCTGAAAGG + Intronic
1001260615 5:170225419-170225441 ATGAGGCTGGAGAGGGAGCAGGG - Intergenic
1001277207 5:170359641-170359663 TTGGGGCTGGAGAGGTAGGCAGG - Intronic
1001465020 5:171956582-171956604 ATGGAGCTGGGGAGCCAGGAAGG - Intronic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1001932132 5:175680692-175680714 ATGGGACAGGAGAGGATGGGAGG + Intronic
1001960101 5:175874800-175874822 GAGGGGCAGGAGAGGCAGGAGGG + Intronic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002173957 5:177391081-177391103 GTGGGGTAGGAGAGGCTGGAGGG - Intronic
1002437260 5:179239154-179239176 ATGGGGGTGGGGAGGCAGGGAGG + Intronic
1002636598 5:180611856-180611878 ATGAGGCAGGTGGGGCAGGCTGG + Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003131922 6:3402137-3402159 ATGGGGCAGGAGAGACACTGAGG - Intronic
1003355537 6:5366017-5366039 AGGCGGAAGGGGAGGCAGGAAGG + Intronic
1003523950 6:6882998-6883020 AGGGGGGAAGAGAGGAAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004698567 6:18057254-18057276 ATGCGGCAGGAACAGCAGGAGGG - Intergenic
1005089520 6:22042257-22042279 AGGGGGAAGGAGAGGGAGGGAGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005835644 6:29706759-29706781 AGAGGGGAGGAGAGGCAGGCAGG + Intergenic
1005841340 6:29746228-29746250 GTGAGGCAGGAGGGGCAGGTAGG + Intergenic
1005885221 6:30092279-30092301 ATGTGGCAGGAGGAGCAGGGAGG + Intergenic
1005894365 6:30164888-30164910 ATGAGGCCGGACAGGGAGGAAGG - Intronic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006091356 6:31630896-31630918 ACGGGAAAGGAGAGGCTGGATGG + Intronic
1006132333 6:31877198-31877220 CTAGGGCAGGACTGGCAGGAGGG + Intronic
1006149194 6:31976943-31976965 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006273258 6:32980769-32980791 AAGGGGCAGGTGGGGCAGGGTGG - Exonic
1006444376 6:34070590-34070612 GTGGGGCTGCTGAGGCAGGAGGG + Intronic
1006448332 6:34092141-34092163 ATGGGGCTGGCTAGGCAGGGTGG - Intronic
1006739406 6:36296692-36296714 AGGGGGGTGGAGAGGCTGGACGG + Intronic
1006844987 6:37055912-37055934 CTGGGGCAGGAGGGCCAGGTGGG + Intergenic
1006880122 6:37331918-37331940 TTGGGGCAGGGGAGGCAGAAGGG + Exonic
1006941529 6:37754934-37754956 AGGGGGCAGGAGAGGATGGGAGG - Intergenic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007180161 6:39923756-39923778 ATGGGGCAGGAGGGAGAAGAGGG + Intronic
1007236623 6:40395052-40395074 TTGGGGCAGAAGAGGCCAGAGGG + Intronic
1007257273 6:40537950-40537972 ATGGGGCAAGAGGGGCTGCATGG - Intronic
1007277804 6:40688600-40688622 AGGGGGCGGGGGAGGGAGGAGGG - Intergenic
1007418777 6:41707042-41707064 TTGGGGCTGGGCAGGCAGGAGGG - Intronic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007921302 6:45612023-45612045 ATGGGGCATGAGAGGTGGGAAGG + Intronic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1009025740 6:57998431-57998453 AGGGGGCAAGAGTGGCAGCAGGG - Intergenic
1009201303 6:60749900-60749922 AGGGGGCAAGAGTGGCAGCAGGG - Intergenic
1009406553 6:63320866-63320888 ATGGGCCAAGAGAGTCAGGCAGG - Intergenic
1009671177 6:66753099-66753121 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
1009994055 6:70879753-70879775 ATGGTGTGGGAGAGGCAGGTGGG + Intronic
1010013225 6:71074058-71074080 ATGGGACTGGAAAGGCAGGTAGG + Intergenic
1010477380 6:76305124-76305146 AGGGGTCTGGAGAGGCAGGGAGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011626923 6:89290543-89290565 GAAGGGCAGGAGAAGCAGGAGGG + Intronic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1011665410 6:89628416-89628438 AAGAGGCAAGAGAGACAGGAGGG + Intronic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013071262 6:106731563-106731585 GTGGGGCAGTAGATACAGGATGG - Intergenic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1013760787 6:113514688-113514710 GTGGGGCAGGAAAGGCGGTATGG - Intergenic
1014129716 6:117816916-117816938 AAGGGCCAGGAGAGGCAAGAGGG - Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1015748920 6:136540387-136540409 AAGGGGCAGGAGGGAGAGGAAGG + Intronic
1015769619 6:136755218-136755240 ATGCGGCTGGAGAGGGAGGCAGG - Intronic
1016304914 6:142673689-142673711 ATTGAGTAGGGGAGGCAGGAGGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017281415 6:152629819-152629841 ATGGGGGAAGAGAGGAAGAAGGG + Intronic
1017557121 6:155583486-155583508 ATGGGGGAGGAGGTGCTGGATGG + Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1018260812 6:161969055-161969077 ATGCTGAAAGAGAGGCAGGAGGG + Intronic
1018676398 6:166226026-166226048 ATGGGGTGGGGGAGGCGGGAGGG + Intergenic
1018767275 6:166944478-166944500 GTGGGGCAGGAGAGGTGGGGTGG - Intronic
1018955870 6:168410306-168410328 ATGGCCCAGGAGTGGCGGGAAGG + Intergenic
1019081128 6:169430490-169430512 TTGGGGCTGGAGATGTAGGAGGG - Intergenic
1019142882 6:169959457-169959479 ATCGGGGAGGGGAGGAAGGAGGG - Intergenic
1019212421 6:170417383-170417405 GTGGGGAAGGAGGGGTAGGAAGG - Intergenic
1019266787 7:121600-121622 GGAGGGAAGGAGAGGCAGGAGGG + Intergenic
1019266796 7:121627-121649 AGGGGGGAGGAAATGCAGGAAGG + Intergenic
1019294146 7:265099-265121 CAGGGGCAGGAGGGGTAGGAGGG + Intergenic
1019294150 7:265108-265130 GAGGGGTAGGAGGGGCAGGAGGG + Intergenic
1019338553 7:496440-496462 ATGGGGCAGAAAAGCCAGGTGGG - Intergenic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019420062 7:946578-946600 ATGGGGCTGGAGCACCAGGAGGG - Intronic
1019540270 7:1548148-1548170 CTGGGGCTGGAGTGGCAGGGCGG - Intronic
1019619715 7:1985773-1985795 AGGGGGCAGTACAGGAAGGAAGG - Intronic
1019632957 7:2059352-2059374 ATGGGGCTGGAGAGGGAGTGTGG + Intronic
1019921040 7:4163434-4163456 CCGGTGCAGGGGAGGCAGGAAGG + Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020129881 7:5553690-5553712 TTCGGGAAGGTGAGGCAGGAGGG + Intronic
1020173393 7:5863416-5863438 ATGGCACAGGAGAGGGAAGAGGG + Intergenic
1020193237 7:6016750-6016772 ATTGGTCAGGAGTGGCAGGCGGG + Intronic
1020201245 7:6081601-6081623 ACTGGGCAGGCGGGGCAGGAGGG + Intergenic
1020262719 7:6539684-6539706 AGGGGGCAGGATAGACAGGCAGG - Intronic
1021689077 7:23214692-23214714 ATTGGGCACGAGAAGCAGAAAGG - Intergenic
1021971061 7:25966600-25966622 AGGAGGCAAGAGAGGGAGGAAGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022174753 7:27862350-27862372 CTGGGGCGGGGGAGGCGGGAGGG - Intronic
1022229546 7:28400576-28400598 AAGGGGGAGGAGAGCCAGGTAGG + Intronic
1022317935 7:29263125-29263147 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1022521328 7:31009035-31009057 ATGGGGGGAGAGAAGCAGGAGGG - Intergenic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1022799408 7:33761496-33761518 TTGGGGGAGGAGAGGCAAAAAGG - Intergenic
1022881159 7:34588752-34588774 ATGGGGTCTGAGAGGCTGGAGGG - Intergenic
1023322801 7:39017605-39017627 ATGAGGTAGGAGAGGCAGAGAGG - Intronic
1023473813 7:40554928-40554950 ATGGGCCAGGATATGCAGAATGG - Intronic
1023484904 7:40675806-40675828 ATGGGGCTGGAAAGCAAGGAAGG + Intronic
1023538342 7:41237904-41237926 ATTGGCCAGGAGGGGAAGGAAGG - Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023763029 7:43484277-43484299 GAGGAGCAGGAAAGGCAGGACGG + Intronic
1023821935 7:43985462-43985484 GAGGGGCAGGAGGAGCAGGAGGG - Intergenic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024101303 7:46035527-46035549 CTGTGGCAGGAGGGGCAGCAGGG + Intergenic
1024326765 7:48114913-48114935 GAGAGGCAGGACAGGCAGGATGG + Intergenic
1024360749 7:48464893-48464915 ATGGAGCAGAGGAGGCAGGGAGG + Intronic
1024539815 7:50467060-50467082 ATGGGGCAGGGCAGGCCGGTGGG + Intronic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025231932 7:57208257-57208279 ATGGGGCAAGAGTGGAAGAAGGG + Intergenic
1025233635 7:57219245-57219267 ATGGAGCTGGAGACCCAGGAAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1025821789 7:64968969-64968991 CTGAGGCAGGAGAGTCAGGCAGG + Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026364331 7:69632542-69632564 GAGGGAGAGGAGAGGCAGGATGG - Intronic
1026501754 7:70948643-70948665 ATGGAGCAAGAGAGATAGGAGGG - Intergenic
1026774536 7:73223311-73223333 AGGGGACGGGAGGGGCAGGAAGG - Intergenic
1026837862 7:73650062-73650084 GGGGGGCAGCAGAGGCAGAAGGG + Intergenic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1027015394 7:74776700-74776722 AGGGGACGGGAGGGGCAGGAAGG - Intronic
1027072637 7:75169255-75169277 AGGGGACGGGAGGGGCAGGAAGG + Intergenic
1027159769 7:75793785-75793807 AAGGGGAAGGGGAGGAAGGAAGG + Intergenic
1027262861 7:76477380-76477402 AGGGGCCAGGAGAGGCAGGGAGG + Intronic
1027314243 7:76975489-76975511 AGGGGCCAGGAGAGGCAGGGAGG + Intergenic
1027510528 7:79073743-79073765 ATGGGGTTGGAGGGGCAGGGGGG - Intronic
1027601140 7:80242786-80242808 GTGAGGCAGGAAAGGGAGGAAGG + Intergenic
1027987180 7:85308256-85308278 ACAGGGCAGAAGAGGCAGGATGG + Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028695041 7:93699441-93699463 ATGGGGCTGGAGAGGTAGACAGG + Intronic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1029085346 7:98007028-98007050 ATGGCACAGGAGAGGGAGGGGGG - Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029127667 7:98305926-98305948 ATGGCCCAGCACAGGCAGGAAGG + Intronic
1029534130 7:101145906-101145928 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
1029750201 7:102538884-102538906 TGGGGGCAGGAGGGGCAGGAGGG - Intronic
1029768152 7:102637992-102638014 TGGGGGCAGGAGGGGCAGGAGGG - Intronic
1029954129 7:104619850-104619872 ATGGGGCAGGTGGGGCAGCAGGG + Intronic
1030288065 7:107847140-107847162 GTGGGGCAGGGGTGGGAGGATGG + Intergenic
1030345633 7:108430105-108430127 ATGAGGCCAGAGAGGCAGCAGGG + Intronic
1030955853 7:115851129-115851151 TGGGGGCAGGGGTGGCAGGAAGG + Intergenic
1030987009 7:116253568-116253590 AAGGGACAGGAGAGGCAAGAAGG - Intronic
1031137679 7:117902771-117902793 ATAGGGGAAGAGAGGCATGAGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032340732 7:131070270-131070292 ATGGGGCAGGAGTGACAGCGGGG + Intergenic
1032379300 7:131459457-131459479 ATGAGGGAAGACAGGCAGGAGGG + Intronic
1032433675 7:131883005-131883027 AGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1032736748 7:134699494-134699516 ATGGAGAAGGAAAGGCAGAAAGG + Intergenic
1032740196 7:134730893-134730915 GTGGGGTGGGAGAGGCAGGTGGG - Intergenic
1033322603 7:140353511-140353533 ATGGGGAAGGTGGGGTAGGAAGG - Intronic
1033411975 7:141126326-141126348 ATTGGGCAGGAGAGGTGGGCTGG + Intronic
1033640319 7:143256908-143256930 CTGGGTCATGACAGGCAGGAAGG + Intronic
1033718553 7:144030721-144030743 ATGAGAGAGGAGAGACAGGAAGG - Intergenic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034263759 7:149772140-149772162 GTGGGGGAGGAGAGGAGGGAGGG - Intronic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034563712 7:151897222-151897244 GTGGGGCTGGAGAGGGAGCAAGG + Intergenic
1034653732 7:152712773-152712795 AGGGGGGAGGAGAGGAAGGGAGG - Intergenic
1034869149 7:154668067-154668089 ATGAGGCAGGAAGGGAAGGAAGG - Intronic
1035050158 7:155994149-155994171 GTGGGGCAGGAGTGGGAAGAGGG - Intergenic
1035183522 7:157108215-157108237 AGCAGGCAGGAGAGGCAGAATGG + Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1036138952 8:6188731-6188753 TTGAGGCAGGAGGGGCAGGAAGG - Intergenic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036201597 8:6775180-6775202 GTGGGGCAGGAGAGGCCGCTTGG + Intergenic
1037352880 8:17981149-17981171 ATGAGTCTGGAGAGGCAGGAAGG - Intronic
1037569666 8:20147771-20147793 ATGGAGGAGGAGAGGCGGGGTGG - Intronic
1037609493 8:20464319-20464341 ATGAGGCAAGAGAGGCACTAAGG + Intergenic
1037666250 8:20972670-20972692 ATGAGTCAGGACAGGCAGCAAGG + Intergenic
1037732715 8:21541730-21541752 ATGGGGCAGGAGAGGAAGCAAGG + Intergenic
1037753757 8:21698600-21698622 ATGGTGCAGGTCAGGGAGGAAGG - Intronic
1037897923 8:22670434-22670456 CTTGAGCAGGAGAGGTAGGAGGG + Intergenic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038074667 8:24058091-24058113 TTGGGGCAGTAGAGGCACAAGGG - Intergenic
1038397527 8:27258105-27258127 AGAGCTCAGGAGAGGCAGGATGG - Intronic
1038625547 8:29189742-29189764 ACTGGGCTGGAGAGACAGGATGG - Intronic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1039324140 8:36466265-36466287 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1039502761 8:38030457-38030479 GTGGGGCGGGAGAGGCGGAAGGG + Exonic
1039762403 8:40591560-40591582 ATAAGGGAGGTGAGGCAGGAAGG - Intronic
1039955252 8:42202448-42202470 ATGGGGCTGGAGAAGCTGCAGGG + Intronic
1040801690 8:51349311-51349333 ATGAGACTGGAGAGGCAAGAAGG - Intronic
1041179928 8:55236668-55236690 CTGGGGCGAGAGATGCAGGAGGG - Intronic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1041830885 8:62151944-62151966 AGGGTGCAGGAGGGTCAGGAAGG - Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042892825 8:73631993-73632015 AGGGGGGAGGAGAGGGAGGGAGG + Intronic
1042939848 8:74096563-74096585 ATAGAGCAGGAGAGTCAGCAGGG - Intergenic
1043941478 8:86200603-86200625 GTGAGGCAGGCGAGGCAGGCAGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044551521 8:93517961-93517983 AGGGAGCAAGAGAGGGAGGAAGG + Intergenic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1045056163 8:98370027-98370049 ATGGGGCAGAAGGGGTGGGATGG + Intergenic
1045990037 8:108296017-108296039 TTAGGACAGCAGAGGCAGGAAGG + Intronic
1046065098 8:109186883-109186905 ATGGCTCAGGAGAGGCAGAATGG - Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1046711660 8:117517798-117517820 ATGGGGCAAGTGTAGCAGGAAGG + Intergenic
1047253346 8:123197107-123197129 CTGGGGCAGGGGTGGCAGAAGGG + Intronic
1047257615 8:123227525-123227547 ATGCGGCGGTATAGGCAGGAAGG + Intronic
1047348803 8:124053954-124053976 ATGAGTCAGGATAGGGAGGACGG - Intronic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047781166 8:128112311-128112333 ATAGGGGAGGAGCGGCAAGAAGG - Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048280406 8:133101525-133101547 ATGGGGCAGGAGGGGCTGGGTGG - Intronic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1049266045 8:141668451-141668473 CTGGGGCAGGAGTGGCAGGGAGG + Intergenic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049519886 8:143082670-143082692 ATGGGCCAGCAGGGCCAGGAGGG - Exonic
1049554131 8:143273867-143273889 AGGGGGCAGGTGAGGCACCAAGG + Intronic
1049577123 8:143394558-143394580 ATGGGCCTGGAGAGGCTGGGTGG - Intergenic
1049704425 8:144034141-144034163 ATTGGCCAGGGAAGGCAGGAGGG + Intronic
1049783020 8:144437367-144437389 ATGAGGCAGGCGGGGCGGGAAGG + Intronic
1049783646 8:144440272-144440294 ATGGGGCACAAGGGGCAGGCAGG + Intronic
1050124032 9:2337851-2337873 ATGGCACAGAAAAGGCAGGAGGG + Intergenic
1050331956 9:4554661-4554683 GAGGGGCTGGAGAGGCAGGCAGG + Intronic
1050432961 9:5580667-5580689 AAGGTGCAGGAGAAGCAGGCAGG + Intergenic
1050811863 9:9758634-9758656 TTGGGGCAAGGGAGGAAGGAGGG - Intronic
1051220842 9:14846904-14846926 ATGAGGCAGTGGTGGCAGGAGGG - Intronic
1051221415 9:14852138-14852160 AGGGGGCAGGAGAAGGATGAAGG + Intronic
1051230290 9:14948684-14948706 AGAGGGGAGGATAGGCAGGAGGG + Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1052475722 9:28956706-28956728 AGGAGGCAGGGGAGGGAGGAGGG - Intergenic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1052991290 9:34520664-34520686 AAGGGGCAGGAGGTGCAGAAGGG + Exonic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053054707 9:34987778-34987800 AAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053280064 9:36814685-36814707 ACAGTGCAGGAGAGGCAGGAAGG + Intergenic
1053433328 9:38058399-38058421 ATGAGGGAGAAGAGCCAGGATGG - Intronic
1053460831 9:38269889-38269911 AAGGGGCAGGGGAGACAGGAGGG + Intergenic
1054227249 9:62469275-62469297 TAGGGGCAGGAGGGGCTGGAAGG + Intergenic
1054733115 9:68721517-68721539 ATATGGTAGCAGAGGCAGGAGGG + Intronic
1055108327 9:72535792-72535814 ATAGGGCAAGGGAGGCAGCAAGG + Intronic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055488124 9:76777066-76777088 ATGGGGCAGGGGAGAAAGAAGGG - Intronic
1055833138 9:80406532-80406554 AGGGGGCTGGAGAGGGAAGAAGG - Intergenic
1056135002 9:83622972-83622994 AAGGGGCAGGAGAGAGAGGCCGG + Intergenic
1056336289 9:85573200-85573222 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1056519079 9:87383512-87383534 ATGGGGCAGGAGATGCCTGCGGG - Intergenic
1056963109 9:91143858-91143880 GTGAGCCATGAGAGGCAGGAAGG + Intergenic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057423479 9:94929965-94929987 AGGGGCCAAGAGAGGCAGGCAGG + Intronic
1057519829 9:95751921-95751943 ATGGGGCCTGAGCTGCAGGAGGG + Intergenic
1057548956 9:96038221-96038243 ATCAGGCAGGGGAGGCAGGAAGG + Intergenic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058390703 9:104492022-104492044 ATGGAGCAAGGGAGGAAGGAAGG + Intergenic
1058397796 9:104575115-104575137 ATGTGTCATGAGTGGCAGGAAGG - Intergenic
1058555043 9:106158223-106158245 ATGGGGCAGGAGTGGAGGAAAGG + Intergenic
1058710479 9:107674854-107674876 ATGGGGCGGGAGCAGCAGGGAGG - Intergenic
1059045079 9:110857919-110857941 ATGGGGCATGAGTGGTTGGAAGG - Intergenic
1059063721 9:111060396-111060418 AAAGGGCGGGAGAGGAAGGAAGG + Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059449449 9:114361176-114361198 ATGTGGCTGGAGAGGCAGGCAGG - Intronic
1059507120 9:114809461-114809483 ATCATCCAGGAGAGGCAGGATGG + Intergenic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060820986 9:126661588-126661610 CTGGGGCAGTTGGGGCAGGAGGG - Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060895667 9:127215632-127215654 TGGAGGCAGGAGAGGCAGGAGGG - Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061120066 9:128636676-128636698 GTGGGGCGGGCGAGGCAGGCAGG + Intronic
1061246039 9:129401718-129401740 AGAGGGCAGGACAGGGAGGAGGG - Intergenic
1061374411 9:130215547-130215569 AGAGGACAGGAGAGGCAGGGCGG + Intronic
1061534469 9:131239086-131239108 AGGGGGCAGGAGGGGGAGGAGGG - Intergenic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061642650 9:131971387-131971409 ATGAGGCAGCGGAGCCAGGAGGG + Intronic
1061668646 9:132175344-132175366 AAGGAGCAAGAGGGGCAGGAGGG + Intronic
1061889235 9:133609022-133609044 GTGGGGCAGAAGACGCAGGCTGG - Intergenic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1061994526 9:134176976-134176998 ATGGGGGAGGAGAGACATGGGGG - Intergenic
1061994541 9:134177022-134177044 ATGGGGGAGGAGAGACATGGGGG - Intergenic
1062044254 9:134417862-134417884 AGGGGGCAGGAGGGTCAGCATGG - Intronic
1062144991 9:134984186-134984208 TAGAAGCAGGAGAGGCAGGAAGG + Intergenic
1062385920 9:136311511-136311533 CTGGGGCTGGAGAGCCAGCAGGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203780006 EBV:95999-96021 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780010 EBV:96008-96030 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780030 EBV:96062-96084 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780060 EBV:96143-96165 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780090 EBV:96224-96246 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780109 EBV:96275-96297 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780128 EBV:96326-96348 GAGGGGCAGGAGGGGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1185445197 X:254183-254205 AGGAGCCGGGAGAGGCAGGAAGG - Intergenic
1185483948 X:468266-468288 CTGGGGCAGGGCAGGAAGGAGGG - Intergenic
1185511620 X:668215-668237 AAAGGGGAGGAGAGGGAGGAGGG - Intergenic
1185599521 X:1329370-1329392 AGGAGGCGGGAGAGGCAGGAAGG + Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185813542 X:3132538-3132560 AGGAGCCGGGAGAGGCAGGACGG - Intergenic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186357396 X:8801672-8801694 AAGGGGCAGGGGTGGCTGGAAGG - Intergenic
1187179861 X:16934136-16934158 ATGGGGCTGGAGAGGGAGCTAGG + Intergenic
1187325979 X:18288901-18288923 AGGGGGGAGGAGTGGGAGGAGGG + Intronic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187498142 X:19814143-19814165 GTGTGGCAGGAGAGGAAGGAGGG - Intronic
1187829960 X:23370996-23371018 GGGGAGGAGGAGAGGCAGGAGGG + Intronic
1187952593 X:24485535-24485557 AGCGGGCAGGAGTGGCAGGAAGG + Intronic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188547621 X:31326628-31326650 ATGGGGCAGGGAAGGAATGAGGG - Intronic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189916208 X:45858131-45858153 GTGGTGCAGGAGGGGCAAGAAGG + Intergenic
1190064188 X:47229205-47229227 ATGAGGCAGGTGGGGCAGGCAGG - Exonic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190290774 X:48990797-48990819 ATGGGGTGAGGGAGGCAGGAGGG - Intronic
1190302612 X:49065383-49065405 AGGGGGCAGGACAGGCTGGGGGG - Intronic
1190842877 X:54162322-54162344 ATTGGGAAAGAGAGGCAGTAAGG - Intronic
1190988729 X:55523601-55523623 ATGGGGATGGAGAGGCAGAAAGG + Intergenic
1191861822 X:65671750-65671772 AGGGGGCTGGTGGGGCAGGAAGG + Intronic
1192127855 X:68518636-68518658 GTGGGAGAGGAGAGGTAGGAAGG + Intronic
1192202060 X:69072729-69072751 ATGGGGGAGGACAGGAAGAAGGG + Intergenic
1192230438 X:69260998-69261020 TTGGGACAGGAGGGGTAGGAGGG - Intergenic
1192232778 X:69277590-69277612 ATGGGGCAGGAGAGATGGCAAGG + Intergenic
1193250800 X:79288854-79288876 ATATGGCAGGAGAGGAAGGGTGG - Intergenic
1193325903 X:80178430-80178452 AGGGGGCTGGAGTGACAGGATGG - Intergenic
1193565772 X:83075204-83075226 ATGGGGCTGGAGAGGTAGATTGG + Intergenic
1193658811 X:84231658-84231680 GTGGGGAAGGATAGGAAGGAAGG + Intergenic
1194585347 X:95726369-95726391 ATGAGGCCAGAGAGGCAGGAAGG + Intergenic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1195702049 X:107712929-107712951 GCGGAGCAGGAGAGGGAGGAAGG + Intergenic
1195917733 X:109952360-109952382 TTTGGGCAGGAGAGGAAGGAGGG - Intergenic
1196030575 X:111091712-111091734 ATGGGCATGGGGAGGCAGGAAGG + Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196813792 X:119649032-119649054 GTGGGGGAGGAGAGGAAAGATGG + Intronic
1197106243 X:122720129-122720151 TTGTGGCAGGAGAGGGATGAGGG - Intergenic
1197336032 X:125210474-125210496 ATGAGGCAGGAGAGGCAGAAAGG + Intergenic
1197678881 X:129361115-129361137 ATAGGGCAGCAGGGGAAGGATGG - Intergenic
1197707623 X:129646082-129646104 ATGAGGCAGGAGACACAGAAAGG + Exonic
1197985654 X:132264258-132264280 ATAAGACAGAAGAGGCAGGAAGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198099807 X:133414374-133414396 ATGGGTGAGGAGAGGCCGGGTGG - Intronic
1198233146 X:134712711-134712733 ATGAACCGGGAGAGGCAGGATGG - Intronic
1198239202 X:134766494-134766516 ATGGGGCTGAGGAGGCAGGCCGG + Intergenic
1198738738 X:139817469-139817491 ATGGGGCTGGAGAGGGAGGCAGG + Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198949098 X:142049720-142049742 ATGAGGCTGGAGAGACAGGGAGG - Intergenic
1199794318 X:151180050-151180072 GTTGGGCAGGACAGCCAGGACGG - Exonic
1199966544 X:152825086-152825108 ATGGGGAAGGAGAGGGAGCTGGG - Intergenic
1200074546 X:153544624-153544646 ATGGGGCGGGAGAGACGGGGAGG - Intronic
1200214920 X:154363914-154363936 GTGGGACAGGGGAGTCAGGATGG + Intronic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1201599602 Y:15713522-15713544 AGGGGTCCAGAGAGGCAGGAAGG - Intergenic
1201945175 Y:19503199-19503221 AGGGGGAAGGAGAGGGAGCAAGG + Intergenic
1202575534 Y:26320641-26320663 ATGGGGCAGAGGGAGCAGGAGGG - Intergenic