ID: 1165161242

View in Genome Browser
Species Human (GRCh38)
Location 19:33817825-33817847
Sequence TGAGACTCCTTCTCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165161236_1165161242 16 Left 1165161236 19:33817786-33817808 CCGAAGTCTCACCACTGCACTCC No data
Right 1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG No data
1165161239_1165161242 5 Left 1165161239 19:33817797-33817819 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG No data
1165161241_1165161242 -9 Left 1165161241 19:33817811-33817833 CCTGGGTGACAGAGTGAGACTCC 0: 10947
1: 44694
2: 106698
3: 138738
4: 144268
Right 1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG No data
1165161240_1165161242 -5 Left 1165161240 19:33817807-33817829 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165161242 Original CRISPR TGAGACTCCTTCTCAAAAAC AGG Intergenic
No off target data available for this crispr