ID: 1165161876

View in Genome Browser
Species Human (GRCh38)
Location 19:33821095-33821117
Sequence CTGATGCAAGAGAAGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165161876_1165161880 -9 Left 1165161876 19:33821095-33821117 CCTCAAGGCTTCTCTTGCATCAG No data
Right 1165161880 19:33821109-33821131 TTGCATCAGGGAGAGGCTTCCGG No data
1165161876_1165161881 3 Left 1165161876 19:33821095-33821117 CCTCAAGGCTTCTCTTGCATCAG No data
Right 1165161881 19:33821121-33821143 GAGGCTTCCGGCACCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165161876 Original CRISPR CTGATGCAAGAGAAGCCTTG AGG (reversed) Intergenic
No off target data available for this crispr