ID: 1165164214

View in Genome Browser
Species Human (GRCh38)
Location 19:33840153-33840175
Sequence TGGGACTCCTTAGGGAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165164208_1165164214 6 Left 1165164208 19:33840124-33840146 CCAACAAGAATGGTAAGGAATAA No data
Right 1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG No data
1165164207_1165164214 7 Left 1165164207 19:33840123-33840145 CCCAACAAGAATGGTAAGGAATA No data
Right 1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165164214 Original CRISPR TGGGACTCCTTAGGGAGAAG TGG Intergenic
No off target data available for this crispr