ID: 1165164244

View in Genome Browser
Species Human (GRCh38)
Location 19:33840338-33840360
Sequence CAGTAAAGGCAGGAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165164241_1165164244 -10 Left 1165164241 19:33840325-33840347 CCTTCAGTATCTTCAGTAAAGGC No data
Right 1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG No data
1165164239_1165164244 11 Left 1165164239 19:33840304-33840326 CCAAGCTGGAGTTCGTTTATTCC No data
Right 1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165164244 Original CRISPR CAGTAAAGGCAGGAGGTGAA AGG Intergenic
No off target data available for this crispr