ID: 1165168499

View in Genome Browser
Species Human (GRCh38)
Location 19:33873472-33873494
Sequence ACATTTAAGCTGATGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165168499_1165168503 29 Left 1165168499 19:33873472-33873494 CCTGAATCCATCAGCTTAAATGT No data
Right 1165168503 19:33873524-33873546 CCATTTCTCAAACACTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165168499 Original CRISPR ACATTTAAGCTGATGGATTC AGG (reversed) Intergenic
No off target data available for this crispr