ID: 1165169627

View in Genome Browser
Species Human (GRCh38)
Location 19:33882589-33882611
Sequence AGCTGGTCCAGGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 541}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165169627_1165169638 30 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data
1165169627_1165169636 24 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169636 19:33882636-33882658 CTCTCAACACCCCTCTGTTAGGG No data
1165169627_1165169632 -7 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169632 19:33882605-33882627 ACCAGCTAACATGGCTGTGGAGG No data
1165169627_1165169637 27 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169637 19:33882639-33882661 TCAACACCCCTCTGTTAGGGAGG No data
1165169627_1165169635 23 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169635 19:33882635-33882657 TCTCTCAACACCCCTCTGTTAGG No data
1165169627_1165169631 -10 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169631 19:33882602-33882624 TGGACCAGCTAACATGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165169627 Original CRISPR AGCTGGTCCAGGCTGGAGCC TGG (reversed) Intergenic