ID: 1165169628

View in Genome Browser
Species Human (GRCh38)
Location 19:33882596-33882618
Sequence CCATGTTAGCTGGTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165169628_1165169638 23 Left 1165169628 19:33882596-33882618 CCAGCCTGGACCAGCTAACATGG No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data
1165169628_1165169636 17 Left 1165169628 19:33882596-33882618 CCAGCCTGGACCAGCTAACATGG No data
Right 1165169636 19:33882636-33882658 CTCTCAACACCCCTCTGTTAGGG No data
1165169628_1165169637 20 Left 1165169628 19:33882596-33882618 CCAGCCTGGACCAGCTAACATGG No data
Right 1165169637 19:33882639-33882661 TCAACACCCCTCTGTTAGGGAGG No data
1165169628_1165169635 16 Left 1165169628 19:33882596-33882618 CCAGCCTGGACCAGCTAACATGG No data
Right 1165169635 19:33882635-33882657 TCTCTCAACACCCCTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165169628 Original CRISPR CCATGTTAGCTGGTCCAGGC TGG (reversed) Intergenic