ID: 1165169630

View in Genome Browser
Species Human (GRCh38)
Location 19:33882600-33882622
Sequence ACAGCCATGTTAGCTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165169630_1165169637 16 Left 1165169630 19:33882600-33882622 CCTGGACCAGCTAACATGGCTGT No data
Right 1165169637 19:33882639-33882661 TCAACACCCCTCTGTTAGGGAGG No data
1165169630_1165169636 13 Left 1165169630 19:33882600-33882622 CCTGGACCAGCTAACATGGCTGT No data
Right 1165169636 19:33882636-33882658 CTCTCAACACCCCTCTGTTAGGG No data
1165169630_1165169635 12 Left 1165169630 19:33882600-33882622 CCTGGACCAGCTAACATGGCTGT No data
Right 1165169635 19:33882635-33882657 TCTCTCAACACCCCTCTGTTAGG No data
1165169630_1165169638 19 Left 1165169630 19:33882600-33882622 CCTGGACCAGCTAACATGGCTGT No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165169630 Original CRISPR ACAGCCATGTTAGCTGGTCC AGG (reversed) Intergenic
No off target data available for this crispr