ID: 1165169633

View in Genome Browser
Species Human (GRCh38)
Location 19:33882606-33882628
Sequence TCCTCCACAGCCATGTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165169633_1165169637 10 Left 1165169633 19:33882606-33882628 CCAGCTAACATGGCTGTGGAGGA No data
Right 1165169637 19:33882639-33882661 TCAACACCCCTCTGTTAGGGAGG No data
1165169633_1165169635 6 Left 1165169633 19:33882606-33882628 CCAGCTAACATGGCTGTGGAGGA No data
Right 1165169635 19:33882635-33882657 TCTCTCAACACCCCTCTGTTAGG No data
1165169633_1165169636 7 Left 1165169633 19:33882606-33882628 CCAGCTAACATGGCTGTGGAGGA No data
Right 1165169636 19:33882636-33882658 CTCTCAACACCCCTCTGTTAGGG No data
1165169633_1165169638 13 Left 1165169633 19:33882606-33882628 CCAGCTAACATGGCTGTGGAGGA No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165169633 Original CRISPR TCCTCCACAGCCATGTTAGC TGG (reversed) Intergenic