ID: 1165169638

View in Genome Browser
Species Human (GRCh38)
Location 19:33882642-33882664
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165169628_1165169638 23 Left 1165169628 19:33882596-33882618 CCAGCCTGGACCAGCTAACATGG No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data
1165169630_1165169638 19 Left 1165169630 19:33882600-33882622 CCTGGACCAGCTAACATGGCTGT No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data
1165169633_1165169638 13 Left 1165169633 19:33882606-33882628 CCAGCTAACATGGCTGTGGAGGA No data
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data
1165169627_1165169638 30 Left 1165169627 19:33882589-33882611 CCAGGCTCCAGCCTGGACCAGCT 0: 1
1: 0
2: 7
3: 60
4: 541
Right 1165169638 19:33882642-33882664 ACACCCCTCTGTTAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165169638 Original CRISPR ACACCCCTCTGTTAGGGAGG AGG Intergenic