ID: 1165170567

View in Genome Browser
Species Human (GRCh38)
Location 19:33889030-33889052
Sequence GTCTGGGGTGAACAGTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165170562_1165170567 9 Left 1165170562 19:33888998-33889020 CCAGCTTCACACAGCTGCTGTGG No data
Right 1165170567 19:33889030-33889052 GTCTGGGGTGAACAGTCAAAAGG No data
1165170561_1165170567 23 Left 1165170561 19:33888984-33889006 CCTTCTGACATGGGCCAGCTTCA No data
Right 1165170567 19:33889030-33889052 GTCTGGGGTGAACAGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165170567 Original CRISPR GTCTGGGGTGAACAGTCAAA AGG Intergenic