ID: 1165173187

View in Genome Browser
Species Human (GRCh38)
Location 19:33907264-33907286
Sequence CCCGCAGAAACCGCGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165173187 Original CRISPR CCCGCAGAAACCGCGGGCAC TGG Intergenic
901841288 1:11955549-11955571 CCCCCAGAAACCACAGGCAAAGG - Intronic
902385388 1:16073064-16073086 CCCGGAGGAACTGCGGGCACCGG - Intronic
904610983 1:31726205-31726227 CCCCCAGAAAGAGGGGGCACAGG - Intergenic
906517364 1:46447755-46447777 CCCTCAGAAACCGAGGGAGCAGG + Intergenic
1076887486 10:133269359-133269381 CAGGCAGAAGCCGCGGGCCCGGG - Intronic
1079354160 11:19715917-19715939 CCCCCAGAACCCCTGGGCACTGG - Intronic
1082785426 11:57313795-57313817 CCCGCAGAAGCCTCAGGCTCAGG - Exonic
1083214503 11:61210047-61210069 CCCCCAGGAACAGCTGGCACAGG + Intronic
1083217387 11:61228876-61228898 CCCCCAGGAACAGCTGGCACAGG + Intronic
1083220378 11:61248624-61248646 CCCCCAGGAACAGCTGGCACAGG + Intronic
1104897734 12:132172513-132172535 CCCGGAGGAACGGCGGGCTCCGG - Intergenic
1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG + Intergenic
1114610703 14:24038197-24038219 CCCAAAGAAACCGCTGGTACTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1121121688 14:91379755-91379777 CCCGCAGGAGGCCCGGGCACGGG - Intronic
1129540962 15:76346741-76346763 CCCCCAGGAACCGCGTGCGCCGG + Intergenic
1133384820 16:5360932-5360954 ACCGCAGAAGCCGTGGGCACTGG - Intergenic
1141430524 16:83968503-83968525 GCCGCGGACACCGCGGGGACTGG - Intergenic
1141571176 16:84934425-84934447 CCCCCAGAAACAGTGGACACTGG + Intergenic
1144075938 17:11719383-11719405 CCCGCAGGACCTGCAGGCACAGG + Exonic
1152601371 17:81263896-81263918 CCAGCAGCAGCAGCGGGCACTGG + Intronic
1154218289 18:12431590-12431612 CCCGGAGCAGCCGCGGGCCCAGG - Exonic
1160711717 19:554883-554905 CTCCCAGAAACCGCAGGCTCAGG - Intergenic
1165173187 19:33907264-33907286 CCCGCAGAAACCGCGGGCACTGG + Intergenic
927965541 2:27265297-27265319 CCTCCAGAAACCGAGGGCGCCGG + Intronic
933950320 2:87323379-87323401 CGTGCGGAATCCGCGGGCACAGG + Intergenic
936329868 2:111538217-111538239 CGTGCGGAATCCGCGGGCACAGG - Intergenic
937853460 2:126656226-126656248 CGGGCAGAGACCGCGGGGACTGG - Exonic
942277262 2:174332504-174332526 CTCGCAGACACCTCGGGCTCCGG - Intergenic
945095791 2:206217822-206217844 CCCGCAGCAGCCACAGGCACCGG - Exonic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
1169088213 20:2840347-2840369 CCCGCAGAGACCGTGGGTCCAGG + Exonic
1178676249 21:34634170-34634192 GCCTCAGAAACCACGGGCCCAGG + Intergenic
1183241386 22:36660329-36660351 CCCGCAGAAGCCATGGTCACGGG - Intronic
1184337437 22:43862121-43862143 CCAGCAGAAGCCCCGGGCGCGGG + Intronic
949549072 3:5097316-5097338 CCCCCACAAACCATGGGCACAGG - Intergenic
953345532 3:42172260-42172282 CCCCAAGAAACCACTGGCACTGG - Intronic
953356853 3:42263536-42263558 CCCGCAGATCCCGCGGGCTCCGG - Exonic
963168042 3:142225175-142225197 CCTGCAGCACCCGCGGGCCCTGG - Intronic
963511119 3:146250850-146250872 CCCGCAGGCACCGCGGCCTCGGG + Intronic
968225450 3:196969569-196969591 CCCGCCGATCCCACGGGCACGGG - Intergenic
968428086 4:536146-536168 CCCGCAGACTCGGCGGGCCCGGG + Intronic
976916901 4:90387433-90387455 CTCTCAGAAACCGAGGGCAAAGG - Intronic
1006499260 6:34447511-34447533 CCGGCAGAAACCGCTGGCCATGG - Intergenic
1007053919 6:38862329-38862351 CCCGCAGGACCTGCTGGCACTGG + Exonic
1019309917 7:354958-354980 CCCCCAGAGACCCCTGGCACAGG - Intergenic
1019793831 7:3035250-3035272 ACCGCAGAAAACGCCGGCACAGG + Intronic
1029496353 7:100897107-100897129 CCGCCAGGGACCGCGGGCACCGG + Intergenic
1036766954 8:11555384-11555406 CCCGCAGAATCCCTGGGCCCAGG + Exonic
1037901201 8:22690620-22690642 CCCGCAGAACTCGCAGGCAAAGG + Exonic
1049586563 8:143435154-143435176 CGCACAGCAAACGCGGGCACTGG - Intergenic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1187391163 X:18887363-18887385 GCGGCAGAAAACGCGGGGACAGG - Intergenic
1198807306 X:140504768-140504790 CCCACACAAGCGGCGGGCACCGG - Exonic
1201755532 Y:17482289-17482311 CCTCCAGAAACTGCAGGCACAGG - Intergenic
1201846020 Y:18423696-18423718 CCTCCAGAAACTGCAGGCACAGG + Intergenic