ID: 1165175640

View in Genome Browser
Species Human (GRCh38)
Location 19:33927802-33927824
Sequence GGTGAGAATAAACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165175640_1165175648 30 Left 1165175640 19:33927802-33927824 CCTGCTGGTGGTTTATTCTCACC No data
Right 1165175648 19:33927855-33927877 CCAGAATCACCCCCAGGATCCGG No data
1165175640_1165175646 24 Left 1165175640 19:33927802-33927824 CCTGCTGGTGGTTTATTCTCACC No data
Right 1165175646 19:33927849-33927871 CTCTAACCAGAATCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165175640 Original CRISPR GGTGAGAATAAACCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr