ID: 1165182057

View in Genome Browser
Species Human (GRCh38)
Location 19:33979904-33979926
Sequence GGTCTAAGGGGAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182057_1165182072 22 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182057_1165182065 -4 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182065 19:33979923-33979945 GACCTCTCCTAGTCCAGAGTGGG No data
1165182057_1165182068 4 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182068 19:33979931-33979953 CTAGTCCAGAGTGGGTCAGCAGG No data
1165182057_1165182071 17 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182071 19:33979944-33979966 GGTCAGCAGGATGAAAGAACGGG No data
1165182057_1165182070 16 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182070 19:33979943-33979965 GGGTCAGCAGGATGAAAGAACGG No data
1165182057_1165182064 -5 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182064 19:33979922-33979944 AGACCTCTCCTAGTCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182057 Original CRISPR GGTCTAAGGGGAAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr