ID: 1165182066

View in Genome Browser
Species Human (GRCh38)
Location 19:33979925-33979947
Sequence GACCCACTCTGGACTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182066_1165182072 1 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182066_1165182073 21 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182066_1165182071 -4 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182071 19:33979944-33979966 GGTCAGCAGGATGAAAGAACGGG No data
1165182066_1165182070 -5 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182070 19:33979943-33979965 GGGTCAGCAGGATGAAAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182066 Original CRISPR GACCCACTCTGGACTAGGAG AGG (reversed) Intergenic
No off target data available for this crispr