ID: 1165182069

View in Genome Browser
Species Human (GRCh38)
Location 19:33979936-33979958
Sequence TTCATCCTGCTGACCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182069_1165182073 10 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182069_1165182075 25 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182075 19:33979984-33980006 AGAAATGGATCTTGTAGGCCAGG No data
1165182069_1165182072 -10 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182069_1165182074 20 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182074 19:33979979-33980001 AATATAGAAATGGATCTTGTAGG No data
1165182069_1165182076 28 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182076 19:33979987-33980009 AATGGATCTTGTAGGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182069 Original CRISPR TTCATCCTGCTGACCCACTC TGG (reversed) Intergenic
No off target data available for this crispr