ID: 1165182072

View in Genome Browser
Species Human (GRCh38)
Location 19:33979949-33979971
Sequence GCAGGATGAAAGAACGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182059_1165182072 15 Left 1165182059 19:33979911-33979933 CCCTTCCCCTTAGACCTCTCCTA No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182060_1165182072 14 Left 1165182060 19:33979912-33979934 CCTTCCCCTTAGACCTCTCCTAG No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182063_1165182072 8 Left 1165182063 19:33979918-33979940 CCTTAGACCTCTCCTAGTCCAGA No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182058_1165182072 18 Left 1165182058 19:33979908-33979930 CCTCCCTTCCCCTTAGACCTCTC No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182061_1165182072 10 Left 1165182061 19:33979916-33979938 CCCCTTAGACCTCTCCTAGTCCA No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182069_1165182072 -10 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182067_1165182072 -4 Left 1165182067 19:33979930-33979952 CCTAGTCCAGAGTGGGTCAGCAG No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182057_1165182072 22 Left 1165182057 19:33979904-33979926 CCTTCCTCCCTTCCCCTTAGACC No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182062_1165182072 9 Left 1165182062 19:33979917-33979939 CCCTTAGACCTCTCCTAGTCCAG No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data
1165182066_1165182072 1 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182072 19:33979949-33979971 GCAGGATGAAAGAACGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182072 Original CRISPR GCAGGATGAAAGAACGGGAG AGG Intergenic
No off target data available for this crispr