ID: 1165182073

View in Genome Browser
Species Human (GRCh38)
Location 19:33979969-33979991
Sequence AGGCAGTGTTAATATAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182069_1165182073 10 Left 1165182069 19:33979936-33979958 CCAGAGTGGGTCAGCAGGATGAA No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182067_1165182073 16 Left 1165182067 19:33979930-33979952 CCTAGTCCAGAGTGGGTCAGCAG No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182061_1165182073 30 Left 1165182061 19:33979916-33979938 CCCCTTAGACCTCTCCTAGTCCA No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182062_1165182073 29 Left 1165182062 19:33979917-33979939 CCCTTAGACCTCTCCTAGTCCAG No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182063_1165182073 28 Left 1165182063 19:33979918-33979940 CCTTAGACCTCTCCTAGTCCAGA No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data
1165182066_1165182073 21 Left 1165182066 19:33979925-33979947 CCTCTCCTAGTCCAGAGTGGGTC No data
Right 1165182073 19:33979969-33979991 AGGCAGTGTTAATATAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182073 Original CRISPR AGGCAGTGTTAATATAGAAA TGG Intergenic
No off target data available for this crispr