ID: 1165182902

View in Genome Browser
Species Human (GRCh38)
Location 19:33987976-33987998
Sequence GTGAATTAGCTGGAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165182897_1165182902 9 Left 1165182897 19:33987944-33987966 CCCAAAGATTTAGTTGAAAGGTA No data
Right 1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG No data
1165182896_1165182902 10 Left 1165182896 19:33987943-33987965 CCCCAAAGATTTAGTTGAAAGGT No data
Right 1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG No data
1165182898_1165182902 8 Left 1165182898 19:33987945-33987967 CCAAAGATTTAGTTGAAAGGTAT No data
Right 1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165182902 Original CRISPR GTGAATTAGCTGGAGAGGGA AGG Intergenic
No off target data available for this crispr