ID: 1165183672

View in Genome Browser
Species Human (GRCh38)
Location 19:33996868-33996890
Sequence TCTCTTCAATGTTGTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165183669_1165183672 9 Left 1165183669 19:33996836-33996858 CCAACAAGACAAAGATGCCTACT No data
Right 1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG No data
1165183668_1165183672 30 Left 1165183668 19:33996815-33996837 CCTCGGCTAAGCAAAAGATTGCC No data
Right 1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG No data
1165183670_1165183672 -8 Left 1165183670 19:33996853-33996875 CCTACTTTTATAACTTCTCTTCA No data
Right 1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165183672 Original CRISPR TCTCTTCAATGTTGTACTGG AGG Intergenic
No off target data available for this crispr