ID: 1165185486

View in Genome Browser
Species Human (GRCh38)
Location 19:34017191-34017213
Sequence CTGCTGTCATACAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165185486_1165185495 28 Left 1165185486 19:34017191-34017213 CCATTTGTCCTGTATGACAGCAG No data
Right 1165185495 19:34017242-34017264 GTACTGCAGGGTGACCTGCCTGG No data
1165185486_1165185493 16 Left 1165185486 19:34017191-34017213 CCATTTGTCCTGTATGACAGCAG No data
Right 1165185493 19:34017230-34017252 CCATCTTTCCACGTACTGCAGGG No data
1165185486_1165185491 15 Left 1165185486 19:34017191-34017213 CCATTTGTCCTGTATGACAGCAG No data
Right 1165185491 19:34017229-34017251 CCCATCTTTCCACGTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165185486 Original CRISPR CTGCTGTCATACAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr