ID: 1165192355

View in Genome Browser
Species Human (GRCh38)
Location 19:34075754-34075776
Sequence CTGTGAGGCTGGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165192355_1165192367 25 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192367 19:34075802-34075824 GCAGAAGCCAGGCTAACCACGGG No data
1165192355_1165192368 28 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192368 19:34075805-34075827 GAAGCCAGGCTAACCACGGGAGG No data
1165192355_1165192364 14 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192364 19:34075791-34075813 CTCATTCCTGGGCAGAAGCCAGG No data
1165192355_1165192361 2 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192361 19:34075779-34075801 TGGCTGTCCTTGCTCATTCCTGG 0: 6
1: 44
2: 99
3: 611
4: 947
1165192355_1165192366 24 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192366 19:34075801-34075823 GGCAGAAGCCAGGCTAACCACGG No data
1165192355_1165192362 3 Left 1165192355 19:34075754-34075776 CCATCTTGCCTCCAGCCTCACAG No data
Right 1165192362 19:34075780-34075802 GGCTGTCCTTGCTCATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165192355 Original CRISPR CTGTGAGGCTGGAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr