ID: 1165199756

View in Genome Browser
Species Human (GRCh38)
Location 19:34134343-34134365
Sequence CTAAATTTGCAGAGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165199752_1165199756 1 Left 1165199752 19:34134319-34134341 CCTGACTGGACTCGTGGCACGGT No data
Right 1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG No data
1165199748_1165199756 7 Left 1165199748 19:34134313-34134335 CCCGCTCCTGACTGGACTCGTGG No data
Right 1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG No data
1165199746_1165199756 22 Left 1165199746 19:34134298-34134320 CCGCAGGGTAGGCGTCCCGCTCC No data
Right 1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG No data
1165199750_1165199756 6 Left 1165199750 19:34134314-34134336 CCGCTCCTGACTGGACTCGTGGC No data
Right 1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165199756 Original CRISPR CTAAATTTGCAGAGGGACCC AGG Intergenic
No off target data available for this crispr