ID: 1165203968

View in Genome Browser
Species Human (GRCh38)
Location 19:34168248-34168270
Sequence AGTGATGAGCATAAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165203968_1165203971 -3 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203968_1165203978 30 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203978 19:34168301-34168323 TGGAACTAGGAGTCCTTATCTGG No data
1165203968_1165203976 17 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data
1165203968_1165203974 10 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203974 19:34168281-34168303 CTGACCTAGGTGTTCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165203968 Original CRISPR AGTGATGAGCATAAGGAGAA CGG (reversed) Intergenic
No off target data available for this crispr