ID: 1165203971

View in Genome Browser
Species Human (GRCh38)
Location 19:34168268-34168290
Sequence ACTAGCCCTAGGACTGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165203964_1165203971 19 Left 1165203964 19:34168226-34168248 CCCCAAATAAACTTCCTTTTATC No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203960_1165203971 28 Left 1165203960 19:34168217-34168239 CCATCCTCCCCCCAAATAAACTT No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203965_1165203971 18 Left 1165203965 19:34168227-34168249 CCCAAATAAACTTCCTTTTATCC No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203962_1165203971 21 Left 1165203962 19:34168224-34168246 CCCCCCAAATAAACTTCCTTTTA No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203961_1165203971 24 Left 1165203961 19:34168221-34168243 CCTCCCCCCAAATAAACTTCCTT No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203966_1165203971 17 Left 1165203966 19:34168228-34168250 CCAAATAAACTTCCTTTTATCCG No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203969_1165203971 -10 Left 1165203969 19:34168255-34168277 CCTTATGCTCATCACTAGCCCTA No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203968_1165203971 -3 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203967_1165203971 5 Left 1165203967 19:34168240-34168262 CCTTTTATCCGTTCTCCTTATGC No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data
1165203963_1165203971 20 Left 1165203963 19:34168225-34168247 CCCCCAAATAAACTTCCTTTTAT No data
Right 1165203971 19:34168268-34168290 ACTAGCCCTAGGACTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165203971 Original CRISPR ACTAGCCCTAGGACTGACCT AGG Intergenic
No off target data available for this crispr