ID: 1165203974

View in Genome Browser
Species Human (GRCh38)
Location 19:34168281-34168303
Sequence CTGACCTAGGTGTTCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165203966_1165203974 30 Left 1165203966 19:34168228-34168250 CCAAATAAACTTCCTTTTATCCG No data
Right 1165203974 19:34168281-34168303 CTGACCTAGGTGTTCAGTCCTGG No data
1165203969_1165203974 3 Left 1165203969 19:34168255-34168277 CCTTATGCTCATCACTAGCCCTA No data
Right 1165203974 19:34168281-34168303 CTGACCTAGGTGTTCAGTCCTGG No data
1165203968_1165203974 10 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203974 19:34168281-34168303 CTGACCTAGGTGTTCAGTCCTGG No data
1165203967_1165203974 18 Left 1165203967 19:34168240-34168262 CCTTTTATCCGTTCTCCTTATGC No data
Right 1165203974 19:34168281-34168303 CTGACCTAGGTGTTCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165203974 Original CRISPR CTGACCTAGGTGTTCAGTCC TGG Intergenic
No off target data available for this crispr